Description :
From Genome Similarity Track
Location :
Scaffold_108:5272- 6324
Sequence
1052 bases(100 bases per row)
ACGAATGTACAGCATTCGATTGATGCATTATGTTTGTTGCTCTTGATGTATTTACTGTGTTCATTATGCAATTTGCTTTGCAAAAAACAAGCAACGATCG
AAAATGCAGCCCAACCTCAAGCCCAAGTTCCTAAAAACGGTGGTAGTCACAGTGATGGCCGTATGTTGCTGCATTGCAGCTTCTCTCGGCACTGCGAAGA
CATCGAGCGATCAAGTTTCCGTCAAGCCTATGCTGCGATATAGCACACCCTCGTCAAGAAATCTGGGATTTTTCAGTAAAATCCTTGGCTGGTGTCGCGA
TAAAAAAGACAAGGTAGTTGGGCAGGTATAACCCTTCCGTGGTATTGCTCAAAAAAAATAGATCTCGTTTGCAATCAATTAAATTGGTGGTTTAAAAGGA
CCTTTTTCGTGAGAACATTTCCTCCTAGATAGTTGCATTTCGCCTTGACTTTAATTTCAGGAATAATTTTGTGAAATGACTTTTCAATCTCATGGAATTC
CCGAATTCATTTTCACTCTTCTTTGCTGGTCGACAAAACCTACACAAAACTCTCGTACTTGACAGATTATGAGCATTCTAGGGCGTAGTGGCTGTGAATG
AATCGAGTCTGTGAAATGAGCGAACTATTTTTTTACATGGTAGATAGTCTTTGATATCGTAATCACAAGCAATACGCATTCGTCATTCGTACCAATACTA
GCCTACCAGACAGGAAGGACTTTAGTGATGTGCATCATGAGCGACTTCATTTCAGCGTAGTTTGTTATCAGTTCTCAGCTTTGAACTTTTTGTTTTACTA
AACTTCCCAATATGTTTCTACTGTAACAGTAAATTACTCTTCTCGCCCATGTAATACTGTACATTGAAGTAGTGTGCACTCGTGCCACGTTTACATTTGT
TAAAGCGCAAGCTTGGTGCATCCTGCTGCGCGTCAAGACCGCTTGACCCTTTGACAGACCGTTCGATTGTCGGTTACAAGCTCATTATAATGACTGTGAA
TTCAGTTACTAAACGACCTGTTGCTCCCTATGTTGTTACGTATCTACGTGTC