Description :
From Genome Similarity Track
Location :
contig_49:52713- 70676
Sequence
17963 bases(100 bases per row)
AAGCACTAAATTTCCGTATTGATTCGAATTCAGGAATGTTATCAGTTGCCAACTCCACTGCCCTCAATTACGAAGTTAACCAACAACTCACAATTACTGT
ATGCGCAAAGGATGGTGGGAATCCACCTTTAGAAGGATGTGGATCTGCTACAGTAATTTTATCTGACGAAAATGATGCACCGACAATAGTGTCTCCTCGG
ACATGTGAAATGGACGAATTTCCTTATCACTTAAATGAACAGGAATTAAATCTACTAGTTGGGAAGATTGTGTGCAGTCTCACGGTTCAAGATGAAGACA
AAAATGGAGCAGCGAACATATCTTGGAAGATACACACGTGGGATATCGTGGAAAATGATCAAAAGAGTCCTTTTAATATTACCCCACAAGGTCAGATTGT
TGTGAACATGCCCCAGAATATCAACTACGAAGAGCAACGTATTTGGTCGATAATGGTACAAGCAAGCGATTTGGGAGGTTTGACTAGTCCCCCGCAGAGA
CTTGACATTGTAGTACGTGATGTTAACGAAAAGCCTCAGCTCCTCGCTACAGCTTTTGACATAGATGAGAACTCACGTTCTGGGGCTGAAGCAACGGGAA
ATCTTACTGTTTTTGACCCCGACACTCGCAATGATGGCCGCCCAGATGCTGTGAAAATCCGCTTGGTTGGCCAGCTGGACATGTTTAACGTTGTGGGTAA
CAAAGTTGTGTTAATGCATGACGGGCTTGATTTTGAATTCAAGTCAACCTACGTGCTTCCATTATCGCGACGGACGAGGGGGCCGAAAGCAGCGTTCTAA
ACGTGAACATTCTGGTCAATAACCTGAACGAGCCACCCATCGTTGAGTCGATGCAACTGAATATTTCGGAAAACCAACCTGTTTTAACGAATGTTTTACC
TGCTGTGAAAGCTCGAGATCCAGACGGTGACACAATTTTTTTTAGCATCGTTTCGGAGTCACCGGAGAGTGGAGTTCCACGGGCCCCAACATCATTTGGC
ATTGATACCCTGACAGGCGTAATATTTCAGCAAGCGGAACAGCTAGACTACGAGGAAACAAGCGAATACGCTTTACTGGTAAGAGCGGGAGACGCGTTTG
GATTATTCTCGATTACCAATGTTACTGTAAAGGTTATCGATATTAACGAGAGGCCAACAATCCGAGTCCAAAGTACGTCTGTACGAGAAGATGCAATTAT
TAGTACACTTGTGGGAAGAAATTTTGTCGACAGCACTATCGATCCCGATTTAAAAAATGGCCATGAAGTGTTTTCCTTTGAGCTTGTGATCACTAATCAG
ACAACCTTTGCCATCGATTTACGGTCAGGTCAAGTGAGTCTGTCGGGTCGTCTAGATTATGAAGCCAAGTCCGTGTACAAGTTACGTGTGCGTGTTATTG
ACCATGGCGGCTTATCTGATGAAACCGATTTCGTTGTATACATTGACGACGTCAATGAGCCACCAAAAATTGGTTCCTTCAATTTTTTTGTACCAGAAAA
CCTTACACCTGGGTCAGCCATAGGAGACCCGGTGACTGCAGTCGACGAGGATATCGATTCCATTATTGAGTATGATCTCGTTGGTTCAAGTGAACCTGTG
TTGGCCTGCATCAGAATCAATTCATCTTCTGGGCAGTTAATGCTTAAAAGTGACAGCTCACTAGATTTTGAGTCTTCTTTCGGGAATAGCCTTCCTATCG
TTGTGCGAGCATCTGATGGAGAGTTCACTGTGGTTTCCAAGAGCGTGATCTACATAACGGACGTTAATGAGCCTCCTATACTGGAGGGATCTCTTCCTAC
ACTTCTACGTGAGAATTCGCCAGATGAAACAGTTGTGTTATTCATACTGGTTCACGATCCCGACAACGGGGACAAGCACCAGTTTTGGGTTTGCGAGCAA
AGCCACTCACAAACATTTCGCGTTCAAAATAGAGGCTTCAACGGCGCAGAGATTATCGTACAGAACTCCACTGCTCTCAATTTCGAATATGTGCCATCGC
TTTGGGTGGATATTTGTGTACAAGACCAAGGGAATCTGACTACGAGATCCAGGTACAGCGTTAATCTATTAACGTGTTGGAACCGCCATACTTCGACCAT
GAAGTGATTCAATTTGATGTAACCGAGAATATTGATGTTGGTAGTGCTATCGGTAAGCCTCTCACTGCTTTTGTTGTTGACGAAGAAAACTTGAATACTG
TTGTGGGATGCTCGGTTGAGATGGTCATTACAAACACGACTTGTGGTCGCCGTACTACATTTTGGCTTGACTCATGTGGTCAACTTACCCTTGCAACTGG
CGGATTGGACTATGAAACCATGCGGGTGTGTGTCGTCTACGTTGTCCTTCCTGATACAAGCGCATACAATGCCAATACTTCATCATTGCACCTTGCGGAT
ACGGCAACGATTATTTTAGCTGTTATTGACGTGAACGAGCCCCAATTTTCTCACAGAAATTATACCAGTTTGCGGTCGCTGAGACGGCAACCAAAGGTAG
CATGATTGGCATTCTATCAGCTTCTGATGTTGATGAGAACTCTGTTTTGGGTTTTCAAATGGTAGACACCGACCCAGGAGATGAGGGTGCATTCATGGTA
TCAGCAGCAGGTATAATCACTCTTACAAAACTGCTGGACTTTGAAACTAAGCAGTATTACCGCCTATTTATTCGTGTAATTGATGAACAGAAGGAATATG
CTGATACAACAGTAATCGTGACTGTCACGGACAGCAATGAACCACCCGTTTTTCAAGCTGATCGATACATGTTCAGCGTTGTGGAGAATGCACCAGTTCA
AACACTAGTCGGGCGTATCACCGCTGTCGACAGTGATAAGTATCAAAACAGCACCATTACGTATACCATCGCAAATGGAAATGACTTAGGCGCTTTTTCA
ATATTATCATTTGGTGGAGATGGGAGCCTGGTCGTAAGTAACCAACTAGCCCTTGATTTTGAAAGACAACAACTCTTTACGGTGCTAGTTGCTGCGACAG
ACAATGGGCCAGGAGGATTATGGAGCTTTTCTACGGTGTCTGTTCGTATTCAAGATATTAACGAACCACCTCAGGTATATCCTCAAACGCTGTATGTCGC
TGAAAATGCTGAGATTGGGTCTTCTGTGTTCACGTCACCAGCTCTTAGTGAAACCTTGACTGGGCAGATGGTTGCATTCGACCCGATTTTAGTGACACAT
TGATTTTTGAGATTGTTGATCCAACGTTCAGTATCGATTTAACTACGGGGGTTATTCGTACGAGACAACAGCTTGATTTTGAGAAAAAGGGGCACTACTC
TTTTTCAGTGGTAGTATCTGATAGTGGCAATCTGTTTACTACAGCGACATTAGACATCGTTGTTTTAGACAGAAATGATGCTCCAACCATTGTCGCTACA
GATTTTTCGATCATTGAGAACCCAAGTCAAAGCTCTATCGTGGGGGTTATACGCATTACCGACGAGGATTTCAACCAGAACCATTTTTTCACTTTGATTG
AAACTACTTTGGTTCTGCGGGACAACTCCACTGTTTTGAGGCCAAAAAACGACGTGGTAACTGTGGGCATGGTCTCAAGCTCCATATAGTTCTTGACGGC
AGTGCTTTTGACTATGAGTTCGTACGTAGTATACAACTAGCCGTGGAAGTTCATGATGACGGCAGCCCGACCAAGCAAGCTACTGGTACTTTGATTATTG
ATGTGATGAACGAGAACGAGAAGTGCACCTTTGAACAGCCTATCATGACATTTTCAATAACAGAGAACACGATTGGTACTGTTGGGCGAGTCGTGGCGAT
CGATCCAGATGCAAATACCTCAATTTCTTGGGGGTTGTGAGTTATTACATGATCGGTGACGGAATGACAGATATCACCGTCGTTGTTTCAGAAATGGGTG
ACATCGTAGTAAACAACCCTTTTGACTACGAGGTTCAACGCCAAATATCATTTAAGGTCGGAGCTGTGGACGGAGGTGGCCTCACATGCACTGCCACAGT
CCAGCTACTTGTGCTTGACATTAATGAGCCTCCGGTTATCAAACCTGGCCGGTTTTGGGTGCCAGAATCTGTCAATGAAGAGCTAGACTGGGTGAGAGCA
ACTGATGGTAGCCACGCTCGGGTGACATTCTGGGACCCCGAAAACGATTCCACGTCACTTTCACAAAACTCATCGAATGTTTTTCATATTTCGAATGATG
GGTTAATATCGCTGCTGAACCCTGTTGACTACGAGCTAAAGTCGTATTACGATCTCTATGTTACTGGGGTGGACAGCCATAACCTTCGCTCAAGCGCGAT
AGTGCGAATCGATGTTGTGGACGTCAACGAACCACCAGTATTCACATCGCAGGCAAAAATGAGTATTGCTGAGGATTCACAGAAAGGGACAGTTGTGGGT
ATCGTGGGAGCTGCTTATGATCCTGACGAGTACGACGTTATTTCATACCAGATCGAAACTGCATTGGATCAGAGCGGAGTATCTGTCGATATTTTTATGA
TACACTCGTGTGATGGAGAAGTGCGGTTGTCTAAATCTAATTCTCTCGACTATGAAATAAACGATCGATACGAGCTAGTAGTAAGTGCAACCGATCGCAC
TGGTCTTAAAACTTTGTCGGATATAATTCCAGTAGAAATCATCGACATCAATGACATGCCGATCTGTGAAGACATGAGACTTTCTGTTTTTGAGAATGCC
TCGGCATCCGAGAGGTTCGGTCCTCTTAAGTGGAATGATCCGGATTCATCTATCAAAAACACGATTACAGTGTTTGAAGTTGTCAGTGATACAGGTGACA
TTGCTTTCGATATTTTTGAGGTTCAGCCCCGTGGTAATGCCTACTGGCTAAAGTTACAACGCTCAGGCACTTTGGACTATGAAAATGTGGCCATGTATAC
GATAACCGTAAAGATTGGTGATAGTTTTGTCTATAGAAACGACTCTGCGGGACAAGTTACGGTATCGTCGTTGTCTTCCACGTGCAGCATAATTATTGAT
GTGCTGGATGTCAATGAACCACCCCACGTCGCAAACGTATTGGAACAGTCTGTTGAAGAAAACACGCCCCTATATGCTTTGGTCGGCGTACCAATCGATG
CATTTGATCCGGATGGTTATGACGTTTTGCACTTCTCAATACTACCTGATGAGGCCAACGGAGTACCTTTCACAATTGATTACAATACGGGTCAAATTCA
TGTGGCCGGAGATTTGGACTATGAGACTCAATCGTTGTATATGTTTGAGGTTGCTGTTGAAGACACAGCTTTAAACTCAGTGGTGACACAAGTCGAAATT
AGGGTTGTGGACATAAATGAGAGACCACAGATACACCGGAACTGCTTAGTTCGTGAAGACGGCACAGCTGATAACCGCTACGAAGAGAACCAGCACGTCT
GCCTCCAAGTATATGAGGACGTGGAAGTTGGATCTATCTTGCATCACTTCGAAGCGATAGACCAGGACAGTGACCAGCGACTGTTTTATTCGATTGACGA
AAATTCAGCTTCCTTCGCTCGGGTGGTTCAAGATACCGATCGAAACTGTAGCCTGTTATACAGTCGCGAGCTCTTTGACTACGAGAGTGCGCGGGTGCAC
CGGGTGCAGTTAATCGTCACAGATACGGGGAAAGGCTTTCTTTCAGATACCGTAACCGTATTCATATTTGTTCTAAACGTCAACGAGCCCCCAGTACTTC
TTCAAGCGTCAGCGTCAGATCTTGTGCTATTTGAAAACTCTGCAAGTGGTCATATATTGGGCCACCTTCAGGGCATGGACCCGGAAGGAGACAAGTTTGT
ATTTTCTCTACAAGATTCGCGTCCTATCGCTAATGCCATCACAATTGATGCTGATGGTTGGGTAGCAACAACGAAAGTAGCTCTTGACTACGAAGCCATG
AGAAAGGTGAATTTCGGTGGGCCTGAGCCAATGCTAACCATACGAGGGGCAGTGACCGCATCGGATAACACCTCGACAAATTTCAATTTTACAATTATGG
TATCGGATGCACCGGAATCGCCTGTGTTCAGACTATCTTCATATGAGCTATCTGTTCATGAACTGGCCCCTGGAGGCTCGCTTATTGGTGTCGTCCAAGC
TACAGATCCCGATTTGAACGATACAATTCAGTATGGATGGAATATGGAGGATACTGCAACCTCAGATGTGAGCAGTATCTTTGCGATATCTTCTGACTCA
GGAGTAATATCCCTGATAAAGCAAGGGGTTTTATATGCAGACAACAATGAAGCTTATCAGCTTAGTGCACGTGTGACTGATTCATCAGGGTTAACGAATT
CCACCAATGTGATTATCTCGGTCGTAAACGACAATGAGCCTCCAATTTGCCCGCCCTTTCAGTGTTGGATACTGGAAAATTCTCCTTTGATTAACAGAGG
ACTGCCTGGGACGCAAGGTTTGTGCCAGATAGTAGTGCAAGACAAGGATGCTGGGCAAAATCACGTTTTTCAATTGATTTCCACAAATGATAGTCGATCG
TTCGCGGTCGATTACGCCACTGGCGTAGTTCAGTTTGCTGCGAATCAACTTACTTTCGCGGATTTTGAAACACAAAGTCTGTATCGCATTCGTTATCAAG
CGAATGATGTTCCAAGTACTGGTGCCTCACTCGCTTGCAGCAACGACATTGTGATTAGTGTTATTGATGTGAATGAAGCTCCAGCAATTTCTGGAGAGCA
GTCTCTAGTTGTGAAAGAAATGAGCGCACATGGTACGATCGTCGGATACGTAAAAGCCATCGACCAAGACTTTGGTGATATATTGAAGTTTTCGTTGCAA
AATGCGGACTCTTCACAGTTTAATATCGATGCAGCAACTGGGGTGCTAACAGTAGTCGACGATTACAAGATAAACTTCGAAACTACACCGTCGATCACCG
TTAACGTTGTTGCAACCGACGTTGCAGGACTTCATGTTTCGGCAACGCTTCTGGTTACGGTTTTGAATGTGAACGATCCGCCAGTGCTACAGCCTGTCAA
CTTTACAGCAAGAGAGTCGGTAGTATCGAAACCAGCCGCATCTACACACTCGCGAAACTTAGAGCAACTGGGGGTGATTCCTTGCTTTGATGAAGACATC
GGTGACGAGTTATATTTCAACATTCTTAACGATACGGCAGCCTTCAGTGTAGAACATAAAAGTGGAATTGTGTATGCGGAAACAGCTTTTCTTGATTTCG
AGACACAACGGCAATATGAACTCAGTGTTCAGTGCTCAGATGGCCAAGCAACTGCGATTACCACCGTCTGGATTCATTTTGAATATCAACGAAGCACCTG
TTCTCACTGGTAAAGCGTACCGCGTGTATGAAAACGCAGTAATTGGAACTAGCTTAGGCTATATTAATGTTTCCGATCCAGAGCACGACGATGAATACTA
TTTGACGCTGACCGAACCAGCTGGAGGCAATGCTATAGTGTCAAGTCTGAAAGAAAAAGGATCTGTATTCTCTGGCTCTTCTGATTTCGAATGGATAGAC
ATTCCACCTCAGCTGGCAAATGCCTTCGTGATATCCACACCTACAGCAGTGTCTTTGTCGAGTACCGCGCTGTTTTTAGCGAGCCGAGGCAGTTTGTTTG
TTTTGGTCGAGCAGGATGCTGACCTTGTTCCAGAGTGGGTATCGAAGAACTCATTCATAAAGAGTGGCGGTCAAACTGCAATAGCACAAAGTAGTGCAAG
TGCGCTTATTTTCGATATATATATAAAAAAACGTCCTCGGGGTGTTTGAGATACCTGACACAACATCAACGAGCATGCTGTGCATTTTTGGTGCGTATCC
GGCTTCTTTAGATTTTTTTCTCCATGGTTCAAAGAGCGATTGGTTTGGTGTCACGGCATCTGGAGAGCTGGTTCTCACTAACCCGACGCTCAATTACGAA
GACATTGATTCCCGCGACCAGCCATTGCAAGTCGTTGTGATTGGTGTCGATAGCGAGGAGTTACTGGGAGAGGCCACATTATTTGTTTTTGTTGATGATG
TGAATGAGGCACCCATCCTTTCTGATAGTTATTTCGAGATTCAAGAGAATCCCGCTGTTGGTACCATGGTTGGTGAGCTTGTTGGTAGTGATCCCGACTT
CAACGATCGGATAGCATTTCAACTAGCATTTCCATCACCAGACGTTTTATTGACGCCGGCTGGACATGTGTCTGTACGCAATAGTTCAAGTTTTGATTTC
GAGAAGAATTCATTGGTCATGGTTCGCATCCAGGTTTCTGATATAGCTGGTCTGTACAGTGACCGCGAAATTCAGATCAAAGTCTTGGATGTTAACGAAC
CTCCAATTTTCCAGCAAGCATACTATTCATTCAGCGTACCTGAAAATTCCATATCGGGGCTACCATTTGGAACGCCCATGCGTGCTATTGATCCGGATCG
TGGTCAGACCGAGAATTTACGATATGAGCTGGTGAATCGAAATGCTGGCGGTTTGCCATTTCGGCTCGAAAGTTGCTCTGGGCAACTGGTAGTACAGTGG
GATAATCTAGACTACGAAAGTACCAATCGCTATTCCTTTGGCGTCCGTGTTATTGATTCAGGATATCCTGTTGCTCTGGAGTCGCAAGCAATCGTGGAGG
TCACGATACTTGATGTAAATGAGGCTCCTCAATTCGCTCACTCTAGTTCTCAAAGTATACTAGAAAACGAACCTAATGGAACGTTTATCGGGACTGTAGT
GGCCACTGATCCTGATAAGAATTCTGAGCTGTTCTTTCGAACGAATGCTAGTGATTATATTCGCGTTTCCGGGAACGGTGGGCTGTATTCGATGGCTCCT
TTTGACTATGAAACAATGCCAGTACTCTATATTGAAATTACAGTCGAAGACAATGGAGTGGGATGCCACATGCTACTGGAGGAGTCTCAGTGTGGGCCAA
TTATTACATCTACTATTATTACTTTATCGGTCCAAAATGTCAACGAACCCCCCACTCTGCTGGCAGATATGTTCGTCATAAAAGAAAATCTCTCTCCAGG
GTCCTTAGTTGGAAGACCTATTCAAATCGTGGACGTTGATGGAGTTGTGGGGAGCAGTTATGGGTTTTTGATAAAAGAAGGTATTTCCAGTGGAAACGAA
TCAGAGTTTTCGATTCGAAGTGATGGTCAGCTGCAAACACTTGTGTCTTTGAATTTTGAAGCAAAGCTCAGTATGAGCTGAAAGTAGCGTATTCTGACGG
TGAGTATTGGTCCTATCTAAACGTTACAGTCACCGTACTCGACGAAAACGAGCCTCCTGAGGTTGTTACTGGCATCAATGGGTCTGTCCCAGAGAATATG
GCTGCTAGTACTAGTGTTTTAGTAGCAAGGTATGTTGATCCTGATCGCAGCTCAGACAATATTTTTGCCCTTGTGGATAGCTTTGCACCGTTCCAAATTG
ATCCACAGACGGGGTCTTTGAAGACAACACGCTCTCTAGACTTTGAGAAGGACCCTACTCGCTTCAATCTTAACATAAGAGTTTGCGATGCAGCGCAGAC
AAGTTTATGTGGAGTGGCTACGTCACAGTAACGGTTACTGATGTCCCCGAGATGCCTTTGATGAGTGATGTTACTTGTGTAATAGTGGAGAATACCCCGA
CTATTTTGAACGAACAAGGCACAGCCGCGTGCACGTTTAGCGCTACTGATCCAGACAGTGCATCGTGCTCGTTCTATCAAATTATCGGGACTAGCGCACA
ATTCCAGTTGGTGGATGACACGACAGTAAATGGATTAGTCTCCGCAGGGGTTCTTGAATCGACTGTATGCATCAACGGTCAAGTGGGCTTAGTTTGGAAA
GGATCATCCCTGCCAGATTACGAAACTCAGTCTCAATATGTGCTTACAGTTCGAATTTCAGACAAGACAGTGAAAACAACGTCTCTATATACTGAGAGTC
GTATAACTGTGACTGTTCTCAACGCAAATGACTGCCCCGTGCTGGCTTCTTTAACATTCACGGTGAGAGAGCGATCCTCTGTCACCACTCAAATTGGCTA
TCCACTTCCGGGTAAAGACCAAGATGTTTCCGATACTCTCACGTACAGCATCTTGGAGACAAATGCTTCAGCGGGTTTGATTCTAATAGACGTGCTGACA
GGTCAACTTCGACTTGGTCGGAACCCTTTAAACGCCGAGCTGGTATACCCGGCTCAATACTACGTGAAAGTTGCTGTTACCGACACCAGCTATGATCACT
GTTCGGGTAACGGACTCATTCAAGTTCTAACGACAAAGTCAAACTTTGCACCTGTCTGGTTAAGCACGTTGCCGTCGTCACTCGTGATAGCTGAAAATTC
AGGGGCAGGAATGCAAGCGGGGGCCTCCCTATCTCATTTTGTCAGTGATCCAGACAGCGACCCAATTCAGTTTACATTGCAGTCGAAAGCCGACACATAC
TGTTCAGACATGTTTATCCTTGGATTGGCAAATGGCGCTCTGACGCTTCGTGCAGGACGCACTTTGGATTTCGAGAAGAAACGCGCATTCGTATGCACAG
TAGCGGCATGTGACCCAGCACACATGTGCAGTACACAAGACGTCACTGTTCAGGTCATAAATGTCAACGAGGCACCTGTATTCAGTGACCAGTCTTACGC
GTTCCAGATAAAAGAGAATGAAGCGGTGAATCTAGCCCTTCCGCGTTGTATCAGTGCGGCTGATCCTGACGAAGGCGATGGTTATTCACTTGCTTACACG
ATTTCGTGTGCAAATACAGCTGATTGCTCTCTTTTCGCGGTACAAGTTGAAGAGGACTATAGCCACGAGCTGTGTGCTAGGATTGTGGTCAAACAAAGCT
TTAACTTCGAGGTACGACAAGTCTACAGCTTCACTTTGATTGCTCAGGATGCTGGTAAGCTGACTGCGGTGGCTGGTATCACAGTTGAAGTGGAGGATGT
AAATGAGATTCATTCATTTATTGGGGTTCCAGCGACATATTCTGTTTTCGAAAATACGGCAATTAACTCGGTCTTGCTTCAAATCAAGACGGCAGACCCA
GATATTTACTCTGACGAATTCAAGACAATTCGGTACGCGATCGATGTGTATCCACCAGGACTGAATGTATTCCGCATTGATGCTGCAAGCGGTGATTTGA
TAGTAGATGGGCTGATAGACTACGAGGCTGTTCAAGCCTATACAGTGAGCGTTGAAGCTCGTGATTCTAGTGGTTTCAATGCGTTTACGATTGTAAACAG
GTCGCGGTCGAAGTGGTTGACGTTCAGATACTACTATTGATACGTTCAGACTTATGGATACCAGCTCCTCAGACCTCGATACGAAGGGGGGTGAAAGGTT
CTTACTCACTGGTTCAAACATTGGGTTCAAGCAACGAGCTGATAACTCAGTTGTAATCAAGCAGCTCATCGTGGAATATGGGGCGTATGGAGCCACTGCA
CTATACCGCGCTACAAGCTGTGGGCTCGTTAATGGGAACACCGGAATTGCATGCACGTCAACGCCGGGTGTTGGCGCAAATCTATACTGGAACGTTACTT
TGGTAATGGAGGTCCCAACTATTGGAGAAACCGTATTCCAAGCATCCTCCTCGGTTCCCCTGGCATCCTATGGTGTTCCGGTTATAGGCTCTGTTGTCTG
CAACAGTGCGCTACCGACCGATGGTAGCAACACAAACAATATTAGGATTTATGGTGAAAACCTGGGGTCAACGCAGATAACAAGCGCAGATGCATATCTT
GTCGTTGTATATGGCTCCGAATTCGAAGCCCAAAGCTGTGAGGTACGCGAAGATGCAACAGGTCATTATATCGCGTGTCGCAGTGTTGTTGGTACAGGCG
CTGATCTCGCATTCGTTGTGGTAGTTCGCGGTCAGGCCAGCACCGCTTTCGCATCTAGCTGTCACTATGCGTTTCCGACTATTTCTGATGTAACTGTGGC
TGCCGGAATGTTGACCACCGGAGGTGACATCGTAATGGTGAACGGAGCTGGATACGGGTGTCAGGGATGTGGCAAAGTCACTGTGTGGTATAGTAACAAC
GTTCACTCGTTTGAGCTTGATGACTGTAAGGTTGTCATTGATCACGTGCAGTTATCCTGTTTATCTCAACCCGGAGCTGGAGGATTATTCCGATGGCAGG
TTTCCGTGGATGATCAGAAGAGTTACTCGACTACTACAATCACAACTTCTTATAAGGCCCCGAACTCTTTGAAGTCATGGGCTTCAAAGATGTTCCTACC
GCGGGAGGAACGGTCTTTGAACTCCGCGGGGAAAACTTCGGACCTGACGGTGCTGTCTATACGGACCCCATTGTCGAGTACTCTTTCGACAATGTTACGA
TCCTTCGCAGTGTCAACTGCAAACGAAAATACAACGATCCGACCAATCATAATTTGATACAGTGTGTGTCTGTGGCTGGTAGTGGCTCGTTCCACTCGTG
GCGTGTCACCATCGAAGGCCAAGCATCCCTGTGGACTGCACACAACTCATCGTATGCAGGACCGATTGTGACAAAAGTGTTTCGCCCGGATGGAGAAACC
GAAATCAAGACAAGTGGGGATCAGCAAGTTGTTATCACGGGCAAGAACTTTGGCACCATCAATGCATCCACCATTTCGAGTGTGACATATGGCGTCAATG
GTGACGAGTTCACGGCTGAGGATTGTGCCATCGTGGTCGACCACGAACGGATCCTCTGTACGACCGCACCTGGTGTGGGCAATCGCCTTGCTTGGATAGT
CACAATCGATGGTTTAACCAGCGCAACGCCCACGATTAGTTATTCAAGACCATTTATCACTTCGATTGAGGGTAATGGGGCCAACGCTCTAGTTCGCGGT
GGGCAGGCAGTCGTTCTTCGAGGAGGCAATTTTGGGCCCGATACTGTAGTCATCGATGGAATTTCGTATGGAAATTCAGGAAGAGACTATCATGTGAAGG
AAGTGCTCGAGCACAATGATTCCACAATCATTTGCACATCTGTTCCTGGTGTAGGGGCGAATCTATCCTGGATGGTGTCAGTCGGTGATCAAGAATCAAG
ATTGTCGACTGCCACGAGCTCATATGCACCGCCTGTGGTTTACTCATTGTACCCTTCCGTTGCATCAACTGATGGGACTACGGAGATTACTGTTATCGGA
GAAAATCTTGGGGCGAACGTGCCTTTCGCAGCAGCACGCGTTGAGTTCACTCCACCGCAAGCAAGTTTGTCAAGTTATCGCATTCCTATAATTGGGTTTG
GAGATTTTAGTGACAGCAACAGCAGCGAGTACATTGTGATTCGTGTACCGGTGGGTTATGGCTATGGTGGATCGCTGCAAGTGTTGGTCGGTACGTCGAG
TGTTCAAAGAAGTGCACCACAGCCAATTAGCTATGGGCCTCCGTTGATTGACTCGGTATCTACGGACGAAGGCCCCACTGAGTGTCTACCTTCTTGCATC
CGACTTACTATTACTGGAAACAATTTCTATACCTCGGGGCGCGTGATAGTGTCAAAGTACCTTATCACCGCAAGCAACCTAGAAGGTGCTAGCTATGAAT
CTTCAGTTGAGGTTTTGTCTTGGTCTCATAACACCATCATAATCCCGCAGTACGTAGGCCGTCTAGGATACGTGACCATTGTGATTGGCAGAGAGAAGCT
GCTGAGTAATTCTGCGCCGTTCAGCTGGGATGATCCGTCCATTCTCGACTGGTACACACTTAGCTCGACCTGCGGGGTACTGGATTGTACAACGAGTCAC
CGATTGGATGGCAACACGAGCTTATTCCGAACAGTAGCAACTACTCCCGTTATGTCGGGGGTGTTTAGCTACCAATCAGCAACTAGTGGTGGAGCTACAC
TAAGTCTATACACGAAGTATGTTGGCCGTAGTCCCCGGGTAACAGTGGGTGGAAACAATTGTACCAATGTCGCGGTGAGCACTCCGGTCATCCCTTCCAG
CATACTTCTGTCTGGGGGGTCACAGGGGTGAGCAATATCCGCCTGATTTCGTGCACAATGCCGAGCGGTCAAGGCGTCATGCTTCCACTTCTTGTAACAC
GAGGTATAACTCTAAGTAGTCCACGGTATTTGAGTTATATTCCGCCAAACGTGGATTGGGACGGAAGCTCTGCCACTTCTGCTTCTACAACCGGAAAGGT
TGTTTCTCTCGTTGGATCAAACTTCGGTACCACGCCAGTCATTTCGATGACTGGGAATTCCAACAGAACTGTTTCACTTGAAATCACGTCGTATGATCAC
TCGCGTGCTACAGTCACTATTCCTCCTGGGGAAGGGCAGAACTACACAATAAAGTTGACCGCGGGGAACCAAGAAACTGCAACGGTGTTTTCCTACAACG
CCCCTGTGATTTATAATGTCGAAGTGGTTGACGCTACCACCGAAGGTGGTTCCTTGATGACGATCCAAGGCGAGAATTTCGGGACAAGCGAGCTATCAGG
CGCTCATACCGTTTTAATTGGTGATATTTTTTCATGCACAATCAACAGTGTTAAGCATGCAGTGATTACTTGCATGACAAGCGAGGGCCAAGGAAGTGGC
CATACAATCGTAGTCACTGTCAGTGGTCAAGTTAATGCTGACAAGAATGTGACTTTCAGCTATGACCCCCCGCTCGTCTACAGCATTAGTAAAAGCAATG
GCCCGACCTCTGGGTATTCCTGCAGCTGCACTGATCCAGACCGTCCCTGCGCAACGCTTTTGGCACCGTTTGAGTGCAATTTCCGAAGCAAGCTCAACTA
CCACCGAGCTTGGTAGCTATTGCGTGGAAACACTGCTAAATGGGGTGTTGCAAAAAGTAACAGTCACTGCAGAGGCAGATGTGTACTCCAGCAACAAGCC
AGTGTACATGAGTGATGTAGCGACAAATGTACAGCTGCTATTCACCGGTGGGGTTTGGCAATTGTTACAAAGTGATGAACGTATTTATCGTGCTAGTACC
GCGACAGTGAACCCAACACCTGCAGGTTGGCTCAATGTGATGGTGGATCCACCCGTTAGTGCGGTGGCTATGAAAGTCAACCCGGGCACTTGCTCAAAGG
CAGCCTCACGTGCCTGTCCTGCAGAAACGGAGCTGTGCGAGAGAGTAGCTATCACACTTGCCGGCAAAAACTTTGGTGTCAGACGTTTGATTGGCACCTG
AGCTGGCCAGCACCGATAGCGTGATGGAATCGGTGAATATTACGAGCGATGACATCGTGTACTTCAGCCATTCAAACATCAAATTCAACTTGCCACCAGG
ACAAGGCATCTCACGTATTGTCAATATGACTGTATCAGGGCTTCAGCTTGCGAACAAATCAATCGCATTCGGCTATCAGAGCCTGAGCTGATCGGCTACG
AAACCAATACGACCAACTTGACTTGCGGAGGTTACACCATCTCTCTTTACGGTAAAAATTTCGGATCAACTCGTGCTAAAGTGCTTATTGGTGGCCGGGA
TGCACGCGTTGATAGCCAAAGTTCTCACCGAGGGCTTGTGGATCCGACACATGTGAATACTCGACCAGCGGTCCCTGTATTGATACTGATACGTTTGTCT
GCTATCCATCGCTGTACGTCGTGAGCCCTACGTTTGGTTTCCTTGAGGTCTGTAACGACACTACAGGGGCTCAAATGATGTGTGAGACAACAGATCCTGC
ACCCGATGTGTCTGAAGATTTCACAAGCCACTCTGACTTTGTAATTGTGACAAGTGTGCCTGCTGGGTATGGTGCTGACGTTTTGGTCTACGTTATAGTT
GACAACCAATCCAGTAACGCCTTAACATTTTCGTACAATCAGCCCGTCATCACTGCTCAGATGCCAAATCAGCCCGATGCAAATGGAGCCAACGCTATCA
CGATCAAGGGTACCGACTTTGGTTGTTTCCCCAATGATGCAATTACCATTTATTTTGCTGGCTCGGACGATACGTCAGATACAGTACAGTCAATATCCCG
CAAATTGAGTTCCCCAGGCATCTCCTACTTGCCAAGTATCTCGAGTATTTTTGAAGACACGTCTCATCGGCAGTTAGTGTCCGACAGTTCAATTGCCTCC
ACAAACGTATCAACAGAGAACTCAACCGGGACCGTAGTCTGGACGAGTGCCTCAGAATTGGTATGGTATCCACCCAAAACGAAGGCTGGTGTTACGAGCA
TTATTCTGTCGGTAGGTGGCAACGTGATGTCTGCTACCAGTCAAACACAGCTGAAGTTTCAATGCAGTCCAGGTTACTACCGAACTTCGACGGAATTCTG
CGACGAGTGTCCAGAGGGGCTACTTGTGCTGGTGGGGACGAGATGCCGTTAGCCAAACCTGGCTACTGGCGTGAAGGTGAGGTTGTCCTCGCATGCGATC
CCATGTATGCGTGCCTAGGTGCCAACAAATGCGCGGAGGGTTATACTGACATAAGGTGCGGCGAATGCGAGACAAACTACCACAAGCTCAATTCAGAGTG
CAACGTGTGCCCGGAGAACAAGTGGGGGTCGTCGCAATTGTGGTCGTCTGTATTAGTGTTGCATCCATCGTGAGTTATCTTCTTACTCGAAAAGGAGTGA
GCCTTGGTCTACTATCTATCGGTATCGATTACTTCCAGACACTCTCCATCTTCGGCAACGCTCGTATTTCGTGGCCAACGTCGTTGATTAATTTATTCGC
GACTCTGTCTGCATTCAACCTCAATTTGGAGCTGATTGCACCCGAGTGTTTTTCACTCCAGGTCTCGTTTGTGAATAAGTGGTTCATCATCGAGGTGTTC
CCACTTGTCATGGCGGCCACGGCGCTCGGGGTCTTTGTAGCTCTTTACGCTTACAAACGCTTTATAAAGAAACGACGCACACTCTAACATCGCACCTTTT
CGGATCAACGCTTGTGATGATGTATTATCTTTTCTTGTATCTCACACGAACGACATTGGATATCTTCAACTGCGTCGGATCGATCCCGTCGGACGGAAAG
CTGTACATGGTGGCCATTTATACTCAGTGCTTCAAACCAGGCGGGTTGCACATGCAGCTCTACGCAGTGCTGGCATTTGTGGTATATTCGCTGGGCTATC
CACTCTTTGTACTTCTGACGTTGTCTCGTAATCGAGCGTTGGTCATGGAAGATCAGCTTCTACGGGCTATGCAGAGAGGAACAAGTCGCCGAACCAATCC
AAACTGCTGGGTGTTCCGCAAGAAGTTTTCAAAATTGTATTATCAATTCAAGCCGGGCTACTGGTACTGGATGGTGCTCATTATCCTGAGGAAGTTCCTA
CTCGCAGGTATCGGGCTTCTGTTCCGTCAAGACCCAGTGTTCCAACTGGCAACAGCGACCTTTGTATTGTTTGTGAACTACGCGCTACAAGTACGCTGCC
GCCCATACATGAGTGTCTATGAGACAGCGGGTCTTAGCGGACTATGCCAAACGAGTCCTGTTGGAAACTCGGCGTGCAAAAGCCAAGGGAGAGGCATTCA
TTCAACCAGCTCACCTGCGTCTTGAAATGCACGCTTCGACGGTAACTGCCTGGAAGAGCGGCCATGGTGACCATGGGGGTAATGGTGTGACTGGTAGTTC
TGCTCCGCCCACTTCAGGACTTCGTGGAGCTAATGAAGCCATCCTCGCATCACAAGAACCGCAGAACGTGGTCGGATATCTCTGGGATCACAACACAGTG
GAGGCGTGTCTCCTGTTCAGCGCTTCTCTCGTGTTACTGGCCGGCGTAATGTTTGAAAGCGGTCGGCTTGGAAGTAACGATACTGGATTCACGAGTACTT
CGGCACAAATGCTGGCCGTTGCCACCACACTTCTTGTAGCCGCAAGTTGTGTGTACTTTGCACTAGTTCTGATAACAGAGCTTGTTGTAGCGCTTCGACC
CGACTACTACAAACGTATTACTCGGGTGCAGAAAGTTTTTAGTCACTGGCATCGCAACCAAAAAGATAAAGAGCAGGGTGGAAAGCGTGGAGATGATGAC
AGTGACGATGACGACGACGACGAGCTCGAGATGGTTGCGACTATGACACAAAATCCGCTGCAT