Description :
From Genome Similarity Track
Location :
Scaffold_39:52704- 54686
Transcript NameFunction/comments
Physo_135529hypothetical protein
Physo_135530NADH-glutamate synthase small chain

Sequence
1982 bases(100 bases per row)
GGACTGAGTGGCTGCAGCCAGATCGACGGTTTGCACTGGCTAAACGGCATTCGGGAGGTGGACCTGAGCTACTGCAACTTCCTGGAGGACGTGTCGTTCC
TCAGCCGCTCACAGCACGTCGACTTGTCCTACTGCCACGCCGTCACGGATCTTTCGCCATTGGCTAGGTGCGAGTCAGTGCAGCTCAACGTGTGTCGGGG
TATCAGCGACGTCAGCTCGTTAAGCCGCGTACGTCGCGTGAGCCTGCGGAATTGTCCGGAGGTGACCGATGTGAGTGCACTAGGCAACGTACACGAGCTG
AACTTGGGTGGCTGCGCGAACGTGGCGAACGTAAGCGCGTTGGGCAACGTGCACGAGTTAAACCTCTCGGGCTGTATCAATGTCACCGACGTCAGTGCTC
TCGGCAAAGTGCACACGCTCAAGCTGCGCAAATGTCTGGGGGTCGTGGATGTTTCGGCACTTGGCGGCGTACAGGACTTGGACCTCACTGGATGCATCAA
CGTCACAGACGTGAGCGCTCTTGGACGTGTCCCCAAGCTCCAGCTCGCGCTCTGCAGACACATTAGCGACATCTCGGCACTGGGCGATGGAGTGCAGGAG
CTCTCCCTTCGGCAATGCGATGCCGTCACCGATCTGTCAGCTCTGACTAAAAGCTCGAGTCTTCGCGACCTGGACCTCTCAGGTTGCACGGCGTTCACAA
GCTCCGAGCTGCAGCATCTGCCTCCACTTGATCGCCTTGTGCTCTCGAGGTGCAGCCAATTAAGGAGTCTTGAAGGTCTGACCCGCGTTCGAGAGCTCGA
CGTGAGCTTCTGCAAGAACCTGCGGTCGCTGGGGTCGTCACTGCGCGAGGTTCACACGATCGTCACCTACCGCTGCGAGAAGCTCGAGGACATCCAAGTG
CTGGCCAAGTCGGCCAAGCACCTAGCGAAGGTGAACTTGTCCGGGTGCTCTCGCATCAGCGACGTCAGCTTTATCTCGGGGGCGCAGGATGTCGACTTGC
GGTTCTGCGACGCACTCGAGGACGCCCGTCCGCTGGCTGAAAGCGCGCGCATCTTGAAGCTCGCCGGGTGCTCGAAGCTCGTGGACGTGTCTCCGCTCGC
ACGCGCTCGAGAGCTGGATCTAAGCTACTGCCCACGTATCGAGGACGTGTCAGCGCTGGAAGCGGTCCACACGCTGTCGCTACGCCACTGCCCGAGCATC
CGAGACGTCTCTGCGCTGTCCAGAGTGCACACGCTCAACCTCTCGGGCTGCGTGCAGCTTGAGGACGTGTCGGCTCTGCGAGATGTGCACGAGCTCAATC
TGTCGGACTGCTGCAAGGTGACGGACGTCGGCATGCTCACGGGCGTGCGCGTGCTGGACTTGCGCTACAACAAGAGCAACGCGGATGCTATAAAGGCCGG
GGTCTCGAAACTGCGCGGTCTTGTGCCCATCATCCGCATGTAGAGCTGCTCATCCAGTAAAGCTTGGATCTAACGCGTAGATGAAGCACTCACCATCCAT
TCTCATCCGATGTCCTCGTGTTTGCGCATAGACGACCTCGGAATTCCCGCGTTGCCGATGGCTCGCGCGGCATCGGGGGCGCCACGCGGCATCAGGCTGT
GCATGTAGACCAACTCGTTCAGCGGATTCACCTCTCCGTGTATTAGAATAATTATCCCTCATCTTTACATCGCTCTGCTCGCTGCGCGAGGCGGTCTCTG
CTGCTTCCTTCCAGCTAGGCTAGGCGCCGTGACGTCGGGTGCAGGGGGCGCCTTCATAGGGCATCGATGCAGGTCTACCGGTACATACTCTCGTCTGAGG
CACGACTTAGCCAAAGCGCTGGTTCTGGGAGACCTCCGGCTGGAAACCCTCCTGCAGGAAGTACTTCTCCACAGCGTCCGCGACGCCGCGGCCCTCGTTG
ATGGCCCACACCACCAGAGACTGGCCACGACGGCAATCACCAGCGGCGAAGACGCCCTCCACCGACGTCTGGTAGTCGCCGT