Description :
From Genome Similarity Track
Location :
scaffold_12:527008- 529100
Transcript NameFunction/comments
Plaha_PHALS_13278Leucine rich repeat proteins%2C some proteins contain F-box
Plaha_PHALS_13279succinate semialdehyde mitochondrial precursor

Sequence
2092 bases(100 bases per row)
ATGAAAGCAACAGCTTTCTATCAACTCGATCAAGAGACTTGAATTCACTTAATGAAAAGTGGATTGAGTATCTTGATCCAGAGACTAATCGTTTGTATTA
CTATAACGAAATAACTGGAGAATCAAAGTGGTCTCTTTCGCCTCGTGAAGACATGCCTTTGGATTTAATTGCTCACATAACGCATCTACAAGAATCTCCA
GTACCATACTCATCACGAGATCAACACATGAGGTGGCTACAAGAGTCGATTACTGCGAAAGAGTGGAACAAAGTTGATGTGATTGTTCAACAGATTTATC
TTCGTGAACAGAGCCAAATGGTACGTGAACGAAAGGAAAGAGTAGACGGAAGTGTTACGAATGAAGTGATGGAGAATGCAGCTTTAGCTCAGATTGAGTC
AAATGGAACGTTATACTCGTGGGTTGAGTATCTCGATGAGAAAAGTGGAGCGTCTTATTACTATAATGAAACTACAGGAGAGTCAACGTGGAAAAGACCA
AGTGATTTTGATTTGAATGGTGCATTACATTAAACGTTAGCACTAACGAGTTTGAATTCATATGATAAATTTCACTGCAATTGCAATTAGCAAAGCGACA
ATACGATTGATTTTCATTCAAGTCCACCAAAGCAAACCATTTTGGTCTCTTGATATTCTTCAAGTCCCATAAACGATCCCTCTCGTCCTAATCCAGACTG
TTTGACGCCACCAAATGGAGCTTGTACAATTGAAATGACGCCTGTATTCACTCCAATCATTCCACATTCTAAAGCAGCCGCAATACGCCAAACTTTCGAA
AGATCTTGCGAGAAAAAGTAGCCAGCAAGTCCAGCTTCTGTTTTGTTGGCCATCTCAATTacttcatcttctgttgtgaaTTTAAATAATGGTACAACGG
GTCCAAAGATCTCTTCGTTTGAGACACGCATCGTATCATTAACATTTGTTAATACTGTTGCTTGATAATAATTGCGTCCCACGTTACTACGTTCGCCACC
AATTAAGACTGTAGCTCCTTTTGCAACGGCATCGTTAACTAAATCCGACGTTTTATCGCAAGCATTGGAGCTAATTAATGGTCCAAGATTCACACCTTCT
TCAAGAGGTGACCCCATTCGCAGTTTCTTGACATTTTCCACAACTTTAGCTGCAAAGCTATCGTAAATACTTGCATGAACAAAAATACGATTGCTACAAA
CACAAGTTTGTCCTGTATTTCGAAATTTCGATGTCATTAGACCTTTGACCGCCTTTTCAAGATCAGCATCATGAAATACAATCAATGGAGCATTGCCACC
AAGTTCAAGTGATAATCGCTTGACAGTCTTTGCTGATTCTTGCATTAAGAGTTTGCCAATTCGTGTAGAACCTGTAAATGAAATCTTACGTACATATTGA
TGATTCGTCAAGACAGTGCCAACTTGTGCTGCTTCATTATTTGGAACGGGGATGACATTAATCACACCAGGTGGTATACCGACACTTTGAGCTAATTTTG
CTAATGCAAGAGCTGATAATGGTGTCTCAGCTGCTGGTTTTAAAACTGCTGTACAACCAGCTGCTAGACATGGACCAAGTTTTCTTGTGATCATAGCAAG
TGGAAAGTTCCAAGGTGTGATAATACCACAGACACCAATGGGTTCTTTCATTGCAAGAAGTTTATGATTTGAAACCGAAGGTGAAGGTAGAAATCCACTT
GAATGCATGATTTCATGAGCATAAAAGTCAATAAAGTCTGCAGCATATGTAACTTCTCCCTTTGCTTCGAGTAATGGCTTTCCACTCTCCATTGAAGCTA
TTAAAGCAAGATCGTCTGTATTCGCAATAATTGCATTGTACCAATTTTTTAATAGTTTGGACCGAGATAATGGTGTGGTTTGACCCCAAATCTTTTGAGC
TTCATAAGCAGCTTCAATAGCCTCGTTTGTCTCACGACTTCCCATATGTGATACACGTGTGATCTCGTTGAGTGTGGAAGGATCAATGACAGCAAAATCT
TGAGCTGAATGAGCTTTTACCCATTTCCCATTAATAAATCCTGTTGACTGGATGAGTGACTTATTGCGTACATTGGAGTGAAAGAAACGACG