Description :
From Genome Similarity Track
Location :
Scaffold_705:5270- 7224
Transcript NameFunction/comments
g15970.t1hypothetical protein

Sequence
1954 bases(100 bases per row)
TCAGTCTTTAGCCTACCGTCTAAGTCATAGTCTGTTCCCTTAGGCCGGGAACCGTGAACTTGTTGTTCACTGAGAGCTTACGCTCTCTAGCACTTCCTCT
GTGCAAGGTACTGTGTGCCCCGTCACACTTGGTAGCACTTGTAATCAATCCACGCCTAATCCGGTAGGATTGGACTACCTGAATCTTCTGTGGTCTCAAG
AGTTGAGCCACCATGGAACGAAATGAGGTTCCTCACTTGAACGTCTCGCAGTTCGGGTCCGTTCAAAAGATGGAAGGCATCTTTGGGAGGGCTGTCTTCC
AAGACTTGGCGTCGGTGACGCCAGCCGACACGTATGAGCGTGAACCCATTGCTCACGTGCAGGGAAACCTGCAGGCCTCTGTGTCCGAGCCGAAGCCTTT
GCGGTTGGTTGTGCCTGTGTTCGAAGGGAAGCAAGGTGATAACCTTCACTTCTGGATCCGAGAAGTTGACATTGCCATGAGGGCGGGTCTCATCTCGGAT
CAGGGACTTCGCGTTGCGTTCGCGTTGTCCAACTTAAGCGGCTGTGCCAAAAATTGGGCGTACACGCTGGAGACGACGTCTCCTGGATGCTTTGCATCCT
GGGCACAGTTGTGCGAGCGGCTTCGCTCTGCTTTTCTCCCGGCGAACGATGCGTTCCACCAGCGCTCACGCTTCCTCACCTGCAAACAAGGGAAGCGCGA
GCTGTACGAGTACGCACAAGAGAGGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGAAGTCAAGATGACGGATCTTCATGGACGGCCT
GAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAATCTCGCTCTCCAGGAGAAGTACAACCATAAGCAG
GCTGGTACTCCGGTCGTTGCAAACAACGAGCCAGAGCCTGTGGACTTGAGCTCTGCTGAGCTGGGCTCGGTCCGCAGCTATAAATGCGGCGGACTAGGAC
ACTACCAACGTGTATTTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGGCCTAACGGTCGCTGGCGCAAGCCGTGGCCAGGTGACCG
AGGGAACTCCGACCACCAGTAGCGGCGAGTCCCCAGAAGGGGGACAGTTGAGTCTCCGTGACAGGTGTGCGGGTGGCGCACACCATGGAGGCTTAGACTA
CGAGAGACTTTATGTATCGAATCAGTGATGGGCAACGCTGGGTTGCCGGTAGTACACGTGAGTGTACGGGAATGTTAATATCCCTAGGAACGTTTAGTTC
CAGGGGCATCGAATGATTTCGTAAGCCGCCGGAGCGATTGCCAACTCTCTGTGCGAGAGCATCGGCAATGATCTGCATATACCATGCGATCAGGTTCACA
TAACTGAATAGCTGCGAGCCGTACGTGGTTGTGGACACGTACGGCGTCTGGTTGGGTGCGCCGTGCTTTGGACGCACGCACTCTGAAGCATTTGGTGCCG
TAAAGCCATCGAGGCTAAACGGCACTCAGCATCTGGCAGAGCATTGGTTAGTCATGACCCCACCACTATCAGAACACACAGTATCCGAAAGGATTACCTG
AACGCAATGGCGTCCGCCGATTTACGGAAGTTGTCCCCATGATCGGGAACTCCGCCAAAGTAGTCGCAGCTGAAGCTGCAACAGGTGATGAGACACCGTT
CAGTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACACGACTAATAGTCCAGCGTGGGGAGCTGCAACGCTAGCAACACCCACCTCTCCTGATCGT
GGCGCCATACGGGCCTCGACTGTATCCGCGTTAGGGGACGTAAGTCTCGCCAGTAGAACAAGTCCACGTGAGGCCAAGGCAGTCGAGACCGTGGCCAGGG
CTGAGGTTGCCGAGAGCACCTCCTGTGTGGGTAACAATGTGCCACACGGAGTCG