Description :
From Genome Similarity Track
Location :
Scaffold_1073:5270- 6763
Sequence
1493 bases(100 bases per row)
GATGATCAGGTCCATTACCACGAGGGCCGGAATCTGTCAGCAGAAGATGTCGAAGGTGAATTAGCTGTGCTTCCTGAAATTGTGATCTCGACGACGGATG
AGGTAAAGATCGATGATATCAAGGTGGGAGATCTGGAGTTCAACACCCTGGAGGAGATCGATCGGCTGCGAAAGAAGATCTGGCACAGGAATCACCTGCT
GATCGGCAAGGGCAATGCACTTCCCCCAGCAGCCCAGGGCGTCACCTGCGACATCGACGTGGGCGACGCGAAGCCGATCACTCAACGTGTCCGGAAAGTT
GCCCCTCAGTTCGTGGAGAAGGTGTCCGAGCTGATCAAGGGATTATTGTCAGCCAAGATGATTCGGAAATCTCGATCACCATGGGCCTCGCCGATCGTCG
TGATCACCAAGAAGAACGGCGTGGATATCCGACTCTGCATAGATTATCGGCTCGTCAACAGTCTAACCAGGCTGATGGTATATCCGATGCCCTTGATCAA
CGATTTGCTGGAGGATCTGGATAAGGTACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGACAATGACCGATCGAGCTCGTGCGATC
TCGGCCTTTATCACCCACATGGGTCTGTTCGAGTGGAACCGGATGCCGTTCGGCTTGAAGAACGCTCCTCAGATCTACCAGCGACTTCTGGACGACGCGT
TTTATGGGTTCACCAGGATCCCGCGATCGTCAGACTGTGAAGTCACTACGGACTTGATCGAGTCAGGAGAACCAGAAGATCCGGGGCGTCCATCAGTGCT
AGGTCGCAGATTGTACATCGATGACATTCTTGTGACGGCCGGATCATGGGATGAGCTGTGCGATCGTGTGGGTCACCTGCTGGACGCTTGTGATAAGTGG
AACATCTCGATCAGTGTGGAGAAGAGCTCTTGGGGGATGCGTAGGTGGACTATCTGGGACATCGTGTGTCGAACGACGGGCTAGAGGCCAATCCGAAGGA
TCTCACCGCTCTGACTGATCTGCTGTTCCCCGGATTGCTCCGATCGATGCAGTCGTTCTTGGGCAGCCTCAATTATTACAGCCGTTTCTTGGAAGATTAC
GCGATCTACGCGGCGATCCTGTACGAACTGCGCGAGGTGGACTTCGCCGAGCTGAAGAAACGCCCCGATCTGCGCCAGATCCTAGATCGTCAAGTGCCGA
ACTTAGTGACTACAGACCCAGTGGACCCGGATCGGACTCCATCAGTTCCCGAAGTCGGTGTCGCCGATGAACGCTGGATCCGTGCTCATCGTGCCTTTTC
GACCCTGAAGATGAAGATCGCGACGACACCGATCCTGCGGTACTTCGATCGCGATCGGACTCCGGTCGTGATTGTGTATGCGAGTGACTGGGCGATCTCG
GCTGCATTGATGCAGGAACACGACCAGATCTATCATCCCGTTACCTTCGCCAGTCGAACGCTGAAGTCGAATGAATTGAACTATAACGTGGTG