Description :
From Genome Similarity Track
Location :
Scaffold_824:5270- 6450
Sequence
1180 bases(100 bases per row)
GTCAATTAGGTTATATGTTTTTTGCTTGTGGATTATCAAATTACCCTTTAGCAATTTTCCATTTATCAAATCATGCTTATTTTAAAGCTTTATTATTTCT
ATGTTCTGGTGCAGTAATTCATGCAATGGGTGATGAGCAAGATATTAGAAAAATGGGGGGTTTAAGACGTATACTACCTTTTACTTATATAATGTTTTTA
ATAGGTTCATTATCATTAATGGGTTTCCCTTTTTTAACTGGATTTTACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAGGTGCTGCGGGCGGTG
GATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCTTCAGCTCGACGTGTCCACCAAG
TCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGAATACCGTCGGGTCTGTCTCACTGCGTCCAACGATCGAAC
GGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGG
TGTTCACAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCCATCCGGAGATCATTGCT
TCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAGGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCA
CCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATG
CATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAAGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAG
TTTGCGCCAAGTGGACGAGTTTTCCAGATCCAAAGTCTCTTCAACCCTGGATCTACACAGAGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGT
CGATTGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCCGTGGATCTGA