Description :
From Genome Similarity Track
Location :
Scaffold_155:52696- 54775
Transcript NameFunction/comments
Aphas_H257_18481myosin-like protein

Sequence
2079 bases(100 bases per row)
CCAAGACGACTTTACGACCGTGCCAGACCTGATCTCGCTCCAGTACCTCCATGAACCGGAGCTTCTGTATGCCGTGTGCGACCGCTATGCCCACGACCTC
ATCTACACGTACATTGGGGAGATCCTTCTATCGTTCAACCCGTTCCAACGCCTCGACATGTATTCCCACAAGTACTTTCAGACGTATGCCGCGTCCTCGG
CCCAAGACATGAGTCTGCCCCCGCACGTGTTTGCGATCGCCGCGAACGCATTCAAAAGCCTGTGCGACGACAAGATGAACCAAAGTATCCTCGTAAGCGG
CGAGTCCGGCGCCGGGAAGACCGAGAACACCAAGTTCCTCATGCAGTACCTCACGCAAGTCGGTGCCATGGGCGTCCCATCATCATCCCCCACCAAGCCG
AGCGTTGTAAAGCGGGGTGGTGGGCGCGGCAAAAAACCTACCGCAGTACATGCTCCCCCCGGACAAATCCAGACCCAAATCCTGCAGACCAACCCGATCC
TGGAAGCATTTGGGAACGCGCGCACCGTTCGAAACGACAACTCGAGTCGCTTTGGCAAGTTCATCGAGCTCCAATTCGGCCGGCACCACACGATTGTCGG
CGCCAAGTTGAGCGTGTACCTGCTCGAGAAGATCCGCGTGAGCCACCAGTCGGACAACGAGCGCAACTTTCACATCTTTTACGAACTGTGCGCCGGCGCC
GACGACGACCTGGCGGCGCACCTGTCGTTGCTGGATGCCGAGGACTTCGACTTGCTGAATGAAAGCGGGTGCTTTACAAGGCGGGACGGCGTCGACGATG
CCGCGCAGTTCCACGAAACATCGCAGGCGTTCACAGACATGGGCATCTTGGCGGACGAACAGCGGAGCATCTACGGCATCGTAGCGGCTTTGCTGCATCT
GGGCAACGTCGCGCTGGACGGCGAGACGTGCGGCGCGTCCAATATGGAGCACGCGAGCATCCGCCCCGACAGTTTGCATCATCTGGACACGGCGGCGGCG
CTGCTGGGGGTGTCGTCGGTGGAGCTCACGTGCGCGCTCGTGACTCGGCATGTGACGACGACCAAGGACAAGATCATGGTCAAGCTGTCGAGTGGCCAAG
CGACCGAAGCCAAGCAGTCGCTTACGCAGAGTTTGTTTGGCGGGCTGTTTGAGTGGATCGTGGCGCGGCTGAGCAGTGTGATCCGACACGACGCCGAGTC
TGCCAATTCGATTGGCATTTTGGATATATTTGGGTTTGAAAACCTCGTCATGAATGGGTTTGAGCAGCTGTGCATCAACTACGCCAACGAACGGCTGCAA
GCGCAGTTCAACGACCTTGTGTTTGCCAAGGAACAGCGCATGTACCAAGCTGAGGGCATCGAGTGGAAGTACATTGAGTACCCCGACAACGCGCCGTGTC
TGCGCCTCCTTGAAGACAAGCCCACGGGCATATGGAGCCTATTAGATGAAGAAGGCATGCTGCCCAAGGGGTCGAACGAAGGCTGGATTGCCAAACTGTA
CAGCCAGTACCTAGACGAAGCAGCAACTACTCTGATGATCGCCGACGACAAGCAGCCGCCGCTCAGTCGACGCCAGTCATGCCCCGAACAACGCAAAGTA
CCAGCGGCGGGCAAGTTGCCGCTGTTTGCATCGAGTTCACAACGGGCCGAGTGTCAGTTTGTGATTGGCCACTTTGCCGGCCGCGTGGTGTATGACAAGG
ACATGTACGTGCAGAAGAACCAGGACGCACTGCCGGTGGAAGCGCTCGAGCTGTGCAGATCGTCGTCGAACGCGATCGTACAGGGGTTGCTCTTGCCGCC
ATCTCAATCTCAACTCAAACAAGGGGGGCGAACCCGAAAATCCCCCCCCACTAGACAAGCAAGCAGTCTTCGGTCGGCTAGTGTGTCGAGCCAGTTCAAA
GGCCAATTAGATGACTTGCTCCAAGTCGTGGGCCGTACCCAAGCTAGATACATTCGCTGTATCAAACCGAATGACGTGAGTACCCCCCGCACAGTCAACA
AGGCGCGAGTGGTGCAGCAGCTGCGGTCCGGCGGGGTGCTGGAGGCCGTGCGCATCGCCCGCGCCGGGTACGCCGTCCG