Description :
From Genome Similarity Track
Location :
Scaffold_7:526932- 529347
Transcript NameFunction/comments
Phyin_T30-4PITG_05127Fatty acid desaturase%2C putative
Phyin_T30-4PITG_05128Putative uncharacterized protein

Sequence
2415 bases(100 bases per row)
ACCGCCACAGAACCAGTCCATGAAGAAGCCCGGCGTAATGTTGCGCGTAGTGGTGACCTGCAACTGCCAGAAGTCGGGCTTGTCTTCACGCTCATACACC
GACATACCGTTGTGGCCCACACTAAAGACAGCAGCCAGGAAGCCGCCACACGACATTTGCGCGAGCATAAAGAAGGCCAGACCCTGAGCCACCGACATGC
CCGTGACAACGGGCAACATAACGTTCCAAATGTAGTGCAACATGAGGCCGACTTTCTCGCCATTCGGAAGATCCACGGGGTCGTATTTACCGAACGCGAA
GCCTTTGAAGACGTAGTAGTAACTCTGCAACAGCCAGCTGAAGCGAGCGAAGAGTAGCAACGGAAAGTAGATGACAGCCTGGTGGCCCACAAAGAACGGA
CCCCAGCTCGACTCGTAGGCTTTCGACGCCATGTGCTTGCTCCAAGCCAACAATGGCATGGTATCGATGTCCGGGTCACCCAAATACTTTGTTTTTTCGT
CCCCAATAATGTTGGGCACGGCGTGGTGGAAGTTGTGCTTGTTCTTCACACTGCACACTGAATCCCATCCAGACGTCACCGATAATGACGCCCCATGACG
TTGCCAATCATGTGGTTGTCCCACACTTGATGGTGCAGCACGTCGTGTGCCAGCCAGCCGGATTGCTGCCAGAAGAGACCCATGACACACGCTGCGAGCA
TGTACATGGGCCAACTGTCAAAGTGCCAGCAGATAGCAGCAGAAGCCATCCAGAGACCGAACGTGCTGAGGATTTTCCACGCGTAGAAGACCATACTGGC
GTCATAGAGGCCCATGCCCTTAATCTTGATACGTAGACGACGGTACGCGCTGATAAACTCGTCGGTCTTGGCTTTCTTAGCCTTCTCCTCCTCCGAGAGG
TCCTCGTTGACCGTCGCCGTGCTCTCATCCACGTCGCCGATGTAGAACTGCTCTAGCTGCTTCCAGGAGCTCGTCGGGTGGCACACAGTGAAGATATCCG
TGGCATCTTCACCCGCCTGGGAGAGCATGACCATGCCGCCCGGGTGGGCGTCCCATTTGCTGATGTCGTAGACCTTGTGGTGGATGACAATCCACGCATT
GTCGTACGACGCGTGCTGCTTGACCTCCTGCCACGAGATCTTGCGCTTGGTCTTGGGGCCGTCCACCATTGGCAGTTATTGAATAAGACAGCTACTTGAT
GTGCGGCTGGAAAGTCGGAGACTGAAGACTGAAGCTGTGGCGAGCGTCGATCACCATACTGAGACCAAGTCACGCGCAACTGTTTCAGTGGTGGAGGCAG
ATCCGAACTGATTATTTTTCCATCGCGCATGGACGGGGTGCATGGATGAGATTTATGTGGCGTACATGAAAATGACAGCCAATCGGAGTCGCTCTCCGGT
TTTTAGCCAATCGTAGTCATCCCGGCGTGACGTCATGATGTGCAAAGAGGTGATGCAGTCAGTTACTGACTCAGTACCTTGGCAATCATCGAAGCTAAAG
GTCGCCAATAAACTGAATCGCCTTGTTGACGAGAAGCTGTCGAGCAGGGCAGGGACGCACACTCGGAAGTATGAAGCTCTACTGTAAGCTACTCGCTACA
TGCAGCTCAAACGCCATGCTGCATTTCTTCAACTAGCAACGTTAAGCTCTTGCCCGGCAGATTACGCGGGTCCGCAAAGATGGGAAGATCGGCCTGCTGC
CACGTACTTCCTGTTGTGATGACCGACAGCCGTAGATTCGACGATACACCAAAGATACTGACATCATTTGGCACTGCCCAGAGCATCCTGCACCTACATG
TAGCGCATCGCGTCGAGGTGTTTTCCGTGGGTCGACGTCTAACGAGGGTATTTAACATTCTTGGCGGTCTATATGTTTGTATTTTCTTTAGTTTGAGCTT
GTGCATGCTGAAGTAGCATACATAGATACACTACGCAAACTACAGAACTACAGTACTTGGTTCACGGTTGCGACGTTGGCGGGGACTGGAATTGTCCTGA
CGAAGGAGTCACATTCGACGATGACGACGCATCCAGCGACGCCGGCATTGGAAGAGGCGAGTCCGTGTCAATCAACATGTCGGACGAGTTGAGCATGCCC
GCGTCGGCAGTCAACGCCGACAAGACCGTGTTGCTGTTCGGAGTCGATGCAGGCGACGCCAACGCGTTCGTGTTGTTGATAGCGTTCGTGTTGCTCAATA
ACCGCGCGATCATCGCCACTTTCTGCGACTCGGAGCAGTCGGTGCGGTTCAATATCGATTGGATCTTGTTCTTGATCTCGGGCATACGGTCCAGTACATG
CAGTAGCGTCGACGTAGTCACCGGCATAGGCGCTCGCGGTGCTTCTGTTCCTGGGAGTACAGAGGCAGCGTTCAACTCCATGGACGCACTGGCGTTCAAT
CCATTGGTCTGCACC