Description :
From Genome Similarity Track
Location :
Scaffold_12:526922- 529451
Transcript NameFunction/comments
Phyra_40437AF511649_6 unknown

Sequence
2529 bases(100 bases per row)
ACAAGCAGCAAAAGTCGATGCTCGACTTCTTCGGACGTCCTGCACCAAATGGACCTTAGCAATAGTTAAGCACCTTTGAATAGTGATAATGACGTGTTTT
GTATCACAAACCAGTAACTAGAGGGTAGAGGTATATTTGACTCGTGCTTGTATGGTGACGGTCATCGGGAGCCCTCCCCATATCTCTCCGTGGAGGGTAT
CACTACTCAGGATATCACGACCGAGAGGATTGTCTGTACCTGCTAGTGCAAGACTACAAGAACAATAAATCGTTGCTGACTTTGAATTCCTTGTCAATCT
TTGAAAGACTGGCGATAAATGTAGTCTACGCTGGGAGTATCGAATTGTTGTCCGCAATGTTTCCTCTCCGAAGCTTGTCTGCCAAACCTCGATTGTTTTC
GCAGCTGCACACGCGCGGAAACACATACCCGTGTAAGCTTAGCGCAGTGTTTGCTCCGAGATGGTCTTGCAGCTCTTCTGTAGCCACCTCGGTGATCGTC
TACACCAAATCCACACAATATATTGCCAATCCATGTCGGAGAGCAAGCGGAGGCGCGTGGACGACGACGCTCGGCGTCTCGAGTTGTGCGCGGAGGACCT
GCGCGAGTTGGGCGCGAGCATCGGGTCCTGCGTGTTCCGCGCACCCTCTACGCACACTATGGTCCCTCTACAAGCCTCCAGTGCCACCCAGGAGCCGCGC
ACGGCGCCCTCGAAGTCGGCGTCTTTTCCGTCGCGTTCGCTCTACTCGCTGGTCTCCAGCGCCGCCTACGCAGCCAAATGCGACGCGCAGACGCGGCCAG
ACACGTGGCAGACGACGCTGCGTCGCCTGGCGTCGGAGTTGGCCGAGCGAAACGCGTCCGACGCGTCGGTCGAGCGGTGCGAGCGGCTCACGCGGCGCTT
CGAGGCGCTTTCCGAGTCTGTGAAGCTTTTGCAGGAGAAGGTTCGAGGCTCAGGGGACGCCCTGGCGCTGCATGACCGAGTGGAGAGTCAGTTGGCCCAG
GAGGAGACGGTGTGGGAGCAGCAGATGCAGGTGCGGGAGCAGCGCGTGGCCGAGCGGGAGGTGGAGCTCAAGGCGCTGCAGGAGGAGGCTGCCGAGGCGG
AAGAGACGGGAGACGAGGCGCAGGAGGAGGAAGAGGAGACGGAGGTGGAGGTCGCAGAGCTGCAGGAGGCCGTGGCACTGCGTGCAGAGGAGAAGCGGGA
CATCGAGGCGGCGGTGGACTCGCTGCAGAGGAAGAAGGCCAGGAAGAACGCTGCTGTTACTGCAGAGAAGGAGAAGACGCAGGTGCTGAGTGGCGATGTG
CGGGCGGATGCGGCCGCGGTGGCCAGGGAACAGGTGCTCGGGGAGTTGAGAGACGAGAAGGAGGCGCTTCAGAGACACATCATCGCGGCCGAGGAGCTGG
AGGAGGAGCAGGAGGAGAACGCGAGGGACTTGCCGGCGTTGAAGGACGAACTGGTGGAAGCCAAGACGGAGCGATCCAGAGTGCAGGCGCAGGTGGACTC
GCTGCGGCTCGAGCTGGCACGACGCAAGAGGAAGATGAGACACATGGTCGACGTGCAGCTCCTGACGGCGCGGGACACCAACCCGCCCACGCTGCGGGAA
GAGGCGGTGCTGCTGCATTTGCTGTACGAACACGAAGGCGAGATGGGCGTGAACGAGCTCAAGCAGGAGGCGAGTGCGGTGCTGCAGGCCCACGGCAAGC
CCAACGGGAACGGCGTGGTCATTCGCGCGCTGTACTCGTTGGTGGCCAATGGTGTCGTGCAGATCGACAGATCCTACGGCAATGGGCTGGTCACGTCGCT
GCTGGTCTAGCAGACCGATCTATACGATTCCGTACGTGAGTGCGTGCTGTTGATCTTTGACAATGCAGGTTTGTGTAGTGTTGGCTGGGCAGAGGGATCT
CGAGAAGGCAAAGCTTGCTGCGAACAGATGCTAAGTAAGCGCACGTCATCGGATGACACTTTGCGTAATCTACACGCGTTTATCCCCTCAGCATCGTTGC
CACGAATCACTGAGTCACTCGTCATTTTCAACACTCAGCTCAAGCCGACAACCACCGGCACGTGCAATGGACAGCTGCGTTCTCCACCCGCCCAACAGTT
TGCACCTGAGCGACAATGTCATCGGCGAAGTGGTGCAGCGGGCGGAATCAGCTCGGAGGAAATCCGTTGCTGGCACGTACGTCATGTTGGATGCCGACGC
TACTCCTTCTCAGACCCACGGCCGGCCCAGAAAGTGTCAGAAGAAGACAAGAGCTCAATCGGCCGTGCCATCGAATGCAAGTTCTGCTGTCCTGGCCAAA
CACCCACAAGCTTCAGGAAGCAACACGCAAGACGCGGCCATGATAGAGCTTGATGTCGCCCAGAAAACGTTCCTGCGAGCACTTCGTCGCACGAGGCAAA
TTCGATACCGCAAGAAGAAGATGGACACGATCATACACCTTGGGGAGGACGTTCGCCAGCTGAATCAAGACATTGACAAGCTCAAGCAGCGGAAGCGAGC
TCTTTCAACAGCCACTCCGCCGAAAGAGA