Description :
From Genome Similarity Track
Location :
Scaffold_1281:5269- 7675
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1281-snap-gene-0.2EF hand family protein

Sequence
2406 bases(100 bases per row)
AGGTCGCAGCCATGGAGAAAGATGGACTGTCGAGTGCGCTGACCGATGAAAAGATCAATGCCGACATGGAGCGTACGCGGCAGCGCAACTCGCGCGCCAA
GTCGAGTATGCTGGACGCGATCGCGCGGGCGTCGACGTGTCCCGGCGCTTCACGGTCCAAGGAGATCGCGCGCATGCACAGCCTGGCCCAGGTCGGCCCG
CTACTCTGCGTCGACACGTTTGAGCGAAAGCAGCAACCGCAGCACATGAAGTTTGCCGAGCAAGACGAGCTGAAAATGGACCGCCGATACATGGAAGACG
AGCTCGGCATTGGCACACCAACTGGGCCCGCTGGTGGGTCACGACGAGGCAGCCTCCGCATGGGGAACTTGGCAACGATCAAGGACCAGATCCGGCTCGC
TCAGCGCCACGCGGCCGATCTGATGGAAAACAAAGTCGCGCTGCAGCGCCACGCCTCAGCCATGTATACCAACCTCAGACAAGCGCAGCGAAAGATCCCG
CACGACTCTACGCGGCATACCAAGCAATCAACTAGTGTCCATTCAATGGGCGATGGGCCGGAAGATACTGAAAACGAGCTGGAGCAACTGCTCGCACCAT
CGCCCTTCCTGCGAAGCAAGTTACCCGAACGGCTTCTGAGTCTTCGCCCACAAACCGCGCCGTCGCCAACGCCAAAGACAGGCCTGACACGAGTCACGAA
CAGCTCTCTGGTACGTGCACCATCTAAGGATAGACCGGTGGAACTTGGGCGGCAAAGAAAGAACCAGCTCGGACCACTCGCATCGAGCGCCTCGGAATCA
GCACTCCAGCAGCCTCGGGGGCCAGCACCGAGTGGAGGTACCAGTCGAAAAAGCTCCCTGGATCAACTGTATCTGGAAGAACTACGCCGCCAGAACCGAC
AGTTGAACATCAAGCGTGTCTCTCTCTCGGAGAATGGACTACCAGCGAATTCGACGACCGAGGGTGAAGACAGCGACTACGTCACAGAACAAGGCTCGCT
GCGGAAGCTGGATGCGATCAATGCCATCATCGACAGAGCCCAGGGCATGTGTGACGCGCGTGCTAAGCCCGCAGAAGAGAGTCGAGCAAATGACGACGAC
CGTGTGTGCGGCCCTGCTCCTCTGCCGTCGACTGGGCCCTTGAGCTGCGGTACTCAAGCACGAAGTCCCCATCGACAACGCTCGGGGTTACTACCCACTC
TCCACGAGACAGAAGATGTTCACTCGGACCAGCATGAAAGAGAAGACGACGCTAGCACCACAGATGATGCCGTGCTCCATCGGCACCTCGACGCCACGCG
GGAGCGAATGGAGATCGCGATGGCGGACGGCGAATCTGGTGGTGACGGTGATGACGAGAGGAGTCTCTCTACGCGATCGCTGATCGACAGGAAGCGCCAG
GACGTCGTGCATCAAAAGAAGGGCAAACGCATGGACGACTATCTCCAGCAAAAGCGCCGCGAAATGAACAACAACATTGGTGCAGTCTTCAAGCGCACGT
CGTTTGCAACCGTGGCAGCAGCGAGTGATGCAAGTAGTAGTACCAGCCACAGCGGCAAGGCCAAGAAGAAGCATCTAAAAGGGACAGCAGCAGCACGCGA
CGCGGCTGTGGACCCACGTGCTGCACTGGAGGCCCACGCACAGGTCGAGAAGAGCCGTGTGTTTGGTATCTATGGCGTCCAGGAAGTCATGTCGGTCATC
AGACTCTTTTGGAGCATGGACGACGACGGGTCCGGCACGCTCTCGCTTGCCGAGCTCATAGCGTACCGCGCGTACTTTGAGAAGCTCGGGTACCACGACA
TGGCCACAGTCTTTCAGGCGGTCGACAGGGACCGAAGCGGCTCGATATCTCTAAAAGAGCTGCTCTCGATTTGTTTCCAGTACGCGACGAAGTTCCAAAT
TGACGAAATGCTCAAGCTCGCCAAGCTCGGAGACGTGGCCAGCTACTTCGACGCGACGCGAAGCCAGCGGCGTCTGAATCCCAATAATGGAGAGACCGCA
CGAGATGGTGAGAAGGGGCGAACCAGCAAGACCTCACTCGACGCAAGGTCCATGGAAGTGCAGTTGTCGCCCGAACAACGTGCAGAACTGCTCGCGATTT
TCCGCGTGTTTGATCGCAACGGCGACGGGGGCATTGCCATGGACGAGATTCTGGAGGCGCTGCATGTGGAGGAAGACGATACTTTAGCTCGGATCGCTGC
TGTCGAAGAGGCCCAGCTCGCCAAGCGAGACGCCGCCTCGCCCGGCATGAAGCGGCGACCGTCGATGGCGGTCCCCACTACGGCGGCATCGCAACGAAGC
ACTGCAAGTGCGTTTACGAAAGAAGAAGTGCGCCGCATGTACGAGAGCGTCGACTCGGACGGCGACCAGTCGCTCAGCTTCGAAGAGTTTCTCGTGCTCA
TGCAAA