Description :
From Genome Similarity Track
Location :
Scaffold_1073:5269- 6753
Sequence
1484 bases(100 bases per row)
TGATGATCAGGTCCATTACCACGAGGGCCGGAATCTGTCAGCAGAAGATGTCGAAGGTGAATTAGCTGTGCTTCCTGAAATTGTGATCTCGACGACGGAT
GAGGTAAAGATCGATGATATCAAGGTGGGAGATCTGGAGTTCAACACCCTGGAGGAGATCGATCGGCTGCGAAAGAAGATCTGGCACAGGAATCACCTGC
TGATCGGCAAGGGCAATGCACTTCCCCCAGCAGCCCAGGGCGTCACCTGCGACATCGACGTGGGCGACGCGAAGCCGATCACTCAACGTGTCCGGAAAGT
TGCCCCTCAGTTCGTGGAGAAGGTGTCCGAGCTGATCAAGGGATTATTGTCAGCCAAGATGATTCGGAAATCTCGATCACCATGGGCCTCGCCGATCGTC
GTGATCACCAAGAAGAACGGCGTGGATATCCGACTCTGCATAGATTATCGGCTCGTCAACAGTCTAACCAGGCTGATGGTATATCCGATGCCCTTGATCA
ACGATTTGCTGGAGGATCTGGATAAGGTACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGACAATGACCGATCGAGCTCGTGCGAT
CTCGGCCTTTATCACCCACATGGGTCTGTTCGAGTGGAACCGGATGCCGTTCGGCTTGAAGAACGCTCCTCAGATCTACCAGCGACTTCTGGACGACGCG
TTTTATGGGTTCACCAGGATCCCGCGATCGTCAGACTGTGAAGTCACTACGGACTTGATCGAGTCAGGAGAACCAGAAGATCCGGGGCGTCCATCAGTGC
TAGGTCGCAGATTGTACATCGATGACATTCTTGTGACGGCCGGATCATGGGATGAGCTGTGCGATCGTGTGGGTCACCTGCTGGACGCTTGTGATAAGTG
GAACATCTCGATCAGTGTGGAGAAGAGCTCTTGGGGGATGCGTAGGTGGACTATCTGGGACATCGTGTGTCGAACGACGGGCTAGAGGCCAATCCGAAGG
ATCTCACCGCTCTGACTGATCTGCTGTTCCCCGGATTGCTCCGATCGATGCAGTCGTTCTTGGGCAGCCTCAATTATTACAGCCGTTTCTTGGAAGATTA
CGCGATCTACGCGGCGATCCTGTACGAACTGCGCGAGGTGGACTTCGCCGAGCTGAAGAAACGCCCCGATCTGCGCCAGATCCTAGATCGTCAAGTGCCG
AACTTAGTGACTACAGACCCAGTGGACCCGGATCGGACTCCATCAGTTCCCGAAGTCGGTGTCGCCGATGAACGCTGGATCCGTGCTCATCGTGCCTTTT
CGACCCTGAAGATGAAGATCGCGACGACACCGATCCTGCGGTACTTCGATCGCGATCGGACTCCGGTCGTGATTGTGTATGCGAGTGACTGGGCGATCTC
GGCTGCATTGATGCAGGAACACGACCAGATCTATCATCCCGTTACCTTCGCCAGTCGAACGCTGAAGTCGAATGAATTGAACTA