Description :
From Genome Similarity Track
Location :
Scaffold_32:526856- 531736
Sequence
4880 bases(100 bases per row)
GCTTCCTCACGCACAGTGTACGTAAGGTAACGGGTTGCTGAAAGCCCGTTACACCTGGTAGCACTTCGTCATCCGTCCAACGCTCACGATTAACGACATG
CCGATGCCCGACGCGCCCAAATTGCCCAACACGTCGCTGGAGCACGACAGCCTTCCCCACCTCTCTTCGATCGAATAGGAGGCGTTGCACCGCCTCGCTG
CTGCGTCCGGCGAGGCTGTCATCCACACGTTGCTCACTGCTGGAACCGAAGCTCAACATCGCCTTGCCGCCCAAGAATTCATGGCGCGTGAGCTCGCTGA
CCTCCGTCAGCGCGTGTCGACTCCCACGCTGTCCAAGAACAGGACTGACATCGTCAAGCTCGATGTCTCCTCTTATAGTGGTGAGGGCGACGGTCGCCTC
CACTTGAACAGATGGTTCTGCGAAGTGGACATCGCAGTCGAAGCCCGGCAGCTTTCCACCGAGCTCGCGCGGACTCGCTTCCTCCTTTCCAAACTGACGG
GGAAGGCAAAGGAGTGGGCCCTCGGCAAACTCGTTGTCAACCCCTCATGCTTTCCCACGATGGCTGCAATGAATCGGACCTGCGACTCGCGTTCGAGCCG
CCCCAAGACGAGAGAGTCCAGCGTTCCGCCTTCCTGTCGTTGCAGCAAGGCAAGAAGTCCATGCTCGAATATATCCAGCGGGCACGTCACCTCATCTCGT
GCATCACGACACATCCGGTTGACATGGCGACCCAAGTCCATGTCTTCGTGCCCGGCATGAACACCGGCTACCAACGCTTCTACTTAACGAGGAAGTCCCC
ATCTACGCTGGAAGAAGCTTTCGCGGTGGCCGTACGCGAAGATTACAGCGTCGCGGCATCTCAAGCTTTCGATTTCAGTCGGGCTCCGGCCTCCGAACCA
GAACCAGAGCCGATGGAGATTGATGCCATCCGCCACTATGATCGTTCTCGGTCGACGACACGTCCACCGCGCTCCCCGACGCGCAGCCAACGTCCGATGA
AATGCTTCCGCTGTCGCAAGCCCGGAAATCGCGCGGCGGTGTGCCGCGCGCCGGCACCTGTCCTGGCAAACGTCACGGTGGAGTCCGAGGTCGTCGTTCC
AAAAAACGGCGACAACCAGTAGGTGCGGGGCGCCCTACTGGGAATGGAAGGAGAGATGCATCTCTGGTGGCAGAGCCTCCTCCTAGCCCTCCAGTGCTTC
ACGCACGACTTTTCGTTACCACTTCCGGCAGCGACTCGAGACTGATTATTCTCAGTCTTCACGTTGACGGCGCCCAGCGCCCGATCCGTGCGTTGCTGGA
CTCCGGCGCGACGAACAACTTCGTTCGCGCCGACAGCTTATCGGTGTTGCCGCAAACCACGCGCATCAGCGAAGGTCCAGGCCACATGGTCGTCAAATAC
GCTGACGGCGAGCCGCGTCGGATGCCCCGGCGCTCGGTCGCCTTCGCGTATGCATTCGACGGGTTCTCCAGCTCGGACGACTTTCTGGTGATCGAGTTGA
GCGGTTCATTCGACTGCGTCTTCGGCATTCCGTGGCTAGTGCGTCACCAGCCTCACATCGACTGGTTGACCCGAACTGTTCGGCCACGCGATATCGATAT
CAACGCAGTACTGGCGTACCTGAGCGGTACGCCCAGCCTCTGGCCACACGTTGCTGTCATGGACCCCGACTCCATGACCACCCCTGCACTTGAAGAGAGC
GATGGCCCTTCATACGCAGCCAGTGCTCCAGCAACTTGTGCCGGTCCTGAGTCGGAGCCTCAGGGCGTTTCCGATGTGGTCGAGCTGAGTATCCCACATC
TTGGTGAGCAGTGGCTCCCACCTCGTGAAGCGGTTGAGCGTGAGTTCCTGCCCGCGGTTGAACAGGGGTTCCCGCGCGCAGTCGAGCTGGAGGTCCCTGA
TGTTGTGGATGCAATCGTTCTACATGATTCGTGTCCCGGCGCCGATGACATACCCCGGCGCCCAACCGATCTCGCAATGATCGAGCGTGAGCTCTCATCG
CCAGATGTACTCCGTCCTGTTCGTCGTCGTAGTCGCCGTAACCCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCGCGACTTAAAGCACGCGACGTCGAACAAGTATGCTT
GCTCGTAGCCTAGCGACACCCGCGTCCATCGCGACTGTCCACGTCGGCCACCGATGCCTCAACGCCGGACCCCCCAGACGCGCCCCACGGGCGCCGAACC
GAAAACAGCCCGTGAAGCGCGCTACGCTGCACAATCGTTACCGGCCCTCGAAGCTTCCGGTAGCCCTGTGGCCCCTCTCGTCCGTGAATTCATCGACATC
TTCCCCGACAAGGTTCCCGGCGGCCCTTCCGCCGGATCGCGGAGTCCGACACGAGATCGATCTCGTGCCTGGCGCCAAGTACTGTGTCACCAGACAGTGG
CCGCTTCCCCGCGACCAAGTCGAGGCGATCGATGCCTTTTTCGAAAGTCGCCGGCAGGCCGGCCACGTTTGCGAGAGCTTGTCACCCCACTCCAGTCCTA
CGTTCTGTGTGAAGAAAGCGACCGGGGGGTGGAGGATCGTCCACGCCTTCAACAAGCTTAACGACGCCACAATCCCGGCACAAACGCCGATCCCACGAAA
AGACATGATTCTTGACTCCATGTCGGGCAGCACCACGTTTAGCGCGATTGATCTGATGGACGGATTCTATCAGATCTTGATGCTCGAAGACGACGTGCCG
CTGACCGCCGTCAGCACGCCCAGTGGAATGCTGTGGGAATGGCTAGTCATGCCGCAGGGGCTCAAGAACGCCCCCGCCACCTTTAACCGCATGGTGTCCC
ACTTGCTGCGTCCATATCGCGACTTCGCGCCCAGTTACTTTGACGACATCTTCATTCATAGTCATGCCGACGCCGGCATGACTGACATCGAAGTTCATCT
CCAACACCTACGAACGGTGTTCGGAGTGATGCGTGAAAACAAGCTCTACGCCAACCTGAAGAAATGCATCTTCTGCGCCCCCGAGATTCCAGTCCTCGGG
AGCTACGTCAGCAAGGACGATGTCCGTGCTGACCCCGAGAAAGTGGCAGCCATCTGCGCCTGGCCATCTCCTCAAGACGCGAAACAGCTCCGACAGTGGC
TCGGCCTCGCGACGTATCTTCATCACTACTCGAAGAACTTCGCGGCGACAGTTCGTCCACTGTCGCAACTACTCAAGACCGATGCCACTTGGACATGGCG
TCCAGAACATCAAGCTGCCTTTGACGCGGTAAAAACGAGCTTATCCACCGCGCCCGTCCTGATGCTGCCTGATCACTCCAAGCCATTTCACGTGGTATGC
GACGCCAGCGACTTTGCCATTGGTTGCGCCTTGATGCAATTCGACGCAGCAGGGCGCGAACGAGTGGTAAGCTACCAGTCGCGCCAGCTGAAACCAGCGG
AACGGAATTACCCCGTACACGACAAAGAGCTACTGGCCATGCGCTATGCGCTGCTCAAGTTCCGAGTTTACCTCTTGGGCGAACAGACCTTCGTCGTGTA
CACCGACCACGCGTCGTTGCGAACCGCAACGAAGAGTCCGCATCTGTCCCAGCGCATGGCGCGCTGGCTCTCCCTTTTCTCCGAATACAACTTTGTTGTT
CACTACAAGCCAGGCAAGACGAACATTCTTGCCTATGCTCTCTCGCGTCGGCCAGATTACGCTCAACTTGGCCGCCACGCGATTGGGGACGAAGACGACG
ACGAGTGCGCCGTGTGTTCTGCTGAAGATGTCACTGCGATGGAAGTCGCAGCGACCAGTTCGTTGCGCGACGCGATCTTGGCCGCGTACGCGTCGGATGC
GGCGTGCTCCGAGCTGATCTCGTTCCTACATGATCCGTCGGAGCCAGCGCGGCGCCGACTGTCCCCGCGGGCCCGATCCCGATTGAGCCGCTTCCGCTTA
CAAGAAGGTTTGCTGACTTACAGTGTGGACAACGAAGACTCACCACGCATCGTCGTCCCGCTGGACGACGATCTTCGCGCCCGATTGATTCACGAGTTTC
ACGATTCTCCCAGTGGTGGCCATCTTGGACGCGAAAAGACCTTCGCGTCCCTCTCTCGCGATTACTACTGGCCGCACATGTACAAGTGGGTGCGTAGTGG
GTTCGCTCATGCGAAGCGTGCCAGCGCGTGAAGCCTTCCCCGTCGAAGCAAGCACCGCTTCGACCCCTCCAGGTGGCCTCGGAGCCGTGGTCCTCCGTCA
GTATGGATTTCGTTTTCGGCCTTCCCCGCGACGCCCAAGGTCGCACTGGCATACTCGTCTTCGTCGATCGATTCAGCAAGATGGTCCATCTTGCTCCAGT
AGCCGCTACGGTCACCGCCAAGCAGTCTGCGGCGACGTTTCTGGATCTTGTTTATCGCCATCACGGCTTGCCAACATCGATCGTTTCCGATCGCGATCCC
CGCTTCACCTCAGCTTTCTGGTCAGAGATCTTCCGGCTTGTCGGGACGCGGTTGAAGATGTCCACCGCGTCGCATCCGGAAACGGACGGCCAGACGGAGC
GTGCGAACAGGGTCGTTGAGGACGTGTTGCGGAGATTCGCCGCGTCATTCACGTCCTGGAGTTCGTTCCTTCCCATGGTCGAGTTCGCGATTAACAATGC
GGTTCACGCATCGACGGGGCTCACTCCATTCTACGTGAACTACGGACGCCATCCCCGCGTCCCTGCCCTCCTTGGCATGG