Description :
From Genome Similarity Track
Location :
Scaffold_144:52659- 55279
Transcript NameFunction/comments
Phymu_g5425hypothetical protein PHYSODRAFT_263945

Sequence
2620 bases(100 bases per row)
GCTGCGTACCGGCGTGCGCTCCGTGTACCTGCCGCAGCACCTTgtcgtgctcgtccacgGCAACAACGGCTCGGCCGCCGACTTTGATGCAGTGGAGGCC
GCGTTGCGCGCCAAATTCGGTGATCACCAGATGCTCATTATCAAATCGAAAGCCAACGAGCCGGACACGTCATTGGGCGTGGAAATTGGCGGCACGAGAC
TCGCTaaggaggtcgtggaggccGTGTTTGAGTACGATCTGAGCCCCGCAGTAAGCAGCTACAAGCTGTCGGTTATTGGACACTCGTTGGGCGGACTTTA
TGCGAGGTACGCACTCGTCCAGATCATGGATACGTTGAGCTGTCTGCACGTGGAATATGTGGATTTCGTGACCATTTGCACGCCGCATTTGGGCTCCAGA
AGGGCAAGAGGACCGTCGACCGTGAAGGTACGTGGGTTTGCATTTTTGCAGTGTGAGAATATGATGACAAAGTCTTAAGTGTTGATGCTGGTGTTTGTAG
AACattcttcgacttggagtGCATAAGGTATTGGCGTCGCGGTCGATATACGGTCTGACAGGCATTGATCTTCTGCTCGATGGTACATTGTATTGTGTTT
AGCTAATTGTCAATCGATTTGGTTTTCTAACCTGTATGATTGTGATACAGCGCAGGGAGTAAcagatgcagaagctgtcgagccGCCTCGCCCGCTGCTT
GAAGTTATGAGCGACCCCGAGTCGGAGTTTGTGCGCTCGCTGAAGCGCTTCCGTCACGGAACGCTGGTAGCGATGACCGACGGTGATGTGGTTGTGCCGT
ATCCCTCAGCCTCCATGCGCAGCTACAGTCCCTACGTCAGTACGTTCTTGACGGAACGCTACATGGATTGGCGGTGGCATATCCGCCACTCTGGCTTCAc
tgaaggtgctgctcaGCCTGCGTACGCAGCATTTCTGGATCGACTCAATTCGAAGATTGACACGTCGATTGAAATCGAGGAGCATGAACTGGGACTTGAT
GCCAGTTGCGCTCCAAGGTTCCCCAGCATCGAAGGATTCGACTGCGACAACAAGCAGGAGGTAGAATTCCCACACGAGATGTTGTgccgtctgcagcagg
tgcttcCGTGGCGACGTATCGACGTGACTGTGGAGCCCTGCGGCGTGAAGGGCAAGATGCGTCTGCACGACTGGCCGATCAACAAGATGCAACCTCCTGA
CTGCCGTGCGGACGAGTTCATCGATCTTCTCTGCGATATGATCGGCGCTGACCATCAAATGCGGCCACTGACGACGCCGGATACTGTTGGCAATTTGCAT
GAAAGTCCTGCGCTCGCACTGGCACGCCGACTGAAAAATGCTGCGAAGCGAACTGTCAAAACGCCGAGCGAGCAAGGCAGTGGTGATAGCGACGCTGAGA
CTCATCACTCAGGGGTGACTTCACCGACCTCAGGCTCATCTGTAGCGTCCAGCGACACTGCCGCGGAGCAGCATCCTGTTCGTGTATAGAATGTTTAAGA
CGCCTAATAATTTACTGGCACGGACTTGATGGAAATGCTTAGATGTAAACACAAAATTCAACAACTGCGATGCACTGTTGACGTCGGTGCCTCCAAGCAC
TTAACCGACAGTAATAGGCAATTCGaccgaagctcaagctgcgcCAGCCCCCATGCCGTCCCCATGACACAGaaacgccttcttccaggTCGTTTGATCT
TCTACAGACAGAGAGAAGCCTTGTTTCGAGCACTTCGCGCCTGCCACTTCACATGCCGTTCTCAGCACAGCATTGAGCGACACGTTTCCACACGACAGTC
CCGCGAGGCTTGCACCGATAAAAGAATCGCCTGCCCCAATTGTCTCAACCACTTCGTCAagacgagcaccagcaatGTGATGCATTTCCGACGTGTGCAC
GTCCAGGTAATAAACACCTTCAGACCCCCAAGGACAAATAAAGGCAATCGAATGGGTTGACAGCTGGACACCCCATTTTTTCGCCGTTACAGCCGCAAAA
AACTGTTTTGCACTTTGAAAGCCAAGCTTCTCGCGGAGATAATCCTTCGACAGGAATATATAATCCGCCATCGAAATGAGCCTGCGCGATTTCAAAGCAA
TACTTTGTGAGAACATATtaagcagcagctttcccGCACGCGTTCACTCACTTTCTTGCAGAGCCCCAGTCGTTGCGAGTTGCTTCAATCTCAACAGAAA
TTTTCGAAGTAGGCATGTTTTCTCGAACGAAAAGCATCATTTTCTCCGCCTCCCCCAAGTTGCGGCCTTCGAAATGAAACCACACCCGATCGCCTTGAGT
TTCTCTACGATACAGCGCGAGCTGTCGTAGAAACGCTTCATAGCTCAATTCACAAAGATTTCTTGAGTTCACAATAGTGCGGGATCCTGTCGCGCGACTT
GAAAGGATGTACTGGGAACGCACAATGTCAGGATACAACCCGAACATAATGCTCAATGGATGGGACTCACCGAAACTGGCATGCTTCCTTCAGCCTCAAT
GCTTGCAAGCGAGCAATCCACGCCAAAGGTCGACAGGTCCTTGTGCACAAACGCAGCATCACTATCCTTTGCCGGGTCTGTCGATACTCCCAACCATCGG
CATCGACCCCCTAGCTGAGC