Description :
From Genome Similarity Track
Location :
Scaffold_19:52657- 56132
Transcript NameFunction/comments
Hyaar_Emoy2803276hypothetical protein
Hyaar_Emoy2803277hypothetical protein

Sequence
3475 bases(100 bases per row)
AAGGAATTGTCGACCGAATTTTAAAATGCAAATCATTGGCTCTTCACCATTGTTGGCGTTAACAACGGATGTATGTTAAAGTCAATGAAGCATGCGATGG
GGTAGTATTGATTGCCTTACCCATTATGTTGCAGAACGACCGCTGCTGAAGCAAAGACAGCGCCTACTGCAGATGGCGCAAGGTACTGCTATAAGTCACA
AAGTTAATGATGGACTTCAAGTGTCGCCAAGGTAAACGCAAGAACAAGACAATAAGAAAAAATAGTGAAATGATGGTGGCTAATCGGTCTCATGTTCGTA
CGTCCGTAAGTCCCCAAGTGCCTACGACACCCAATAAAAAGTAATCAGCCATACAGCAAAAACTCTGGCGTGGGCAAACTAAGAGAGCGATCACGATGAG
AATACATCGACCCGCCCCAATAATGGATTCATCCTCAAACAGAAGTAGGCATATATTACGAACCCGAAAGGTGAATCAAATAGAAAGTGTGTGTAAGGTC
TAGCCAGAGTTTGACGGGCTACTATATGTCTTCTTGTCATGCAGGTGTACCGTACACGTTTTGCTAGGTAGGATCTTGCAATTGTATTATTGCGAGCCCG
AAGATATACCTATTACTGACAGAGCGTAGGGCACGTGAATATACAGAACATGATTCAGTTGATGGACAAGATTACTAATATCATAGGGCGAGCTCTAGAG
CTTGCTCCCCTTATCTTATTTTGGTACAAATGCACGTAGTGTAACGGGGTGAGCCTGTTACATGTAATTAAATCTTGATACTTGTTAATTAGGATATTAT
CATAAAAGCTGATAATGTTCGTGAATATTACCATAAGGTGTAATATTCAGAAACACTAACCGATTGGCTGATATGGGTCATCATATCAGCCAGCTCTAGC
GGGCCAATCAACGATGGACGCGCGCAATGAGTGGTGAGCAAGACTTTAGCATACGTTTTTGTAGATAAATATAATTAAGTTAGGACTAAAACATAGGTTA
ATGATTAGGACTTAATTAAATTTAATACAGTTTTACTTTTACCAACAACTAGACTGGCTCTAGTTGTTTACCTTCCTCTGCACGTTTGCTTAGAGGTAGC
GAGGCACCACTAGCACTGCTGTCGGTGATAGTATCTCCACACTGGTTGTCCAGTGTGTTGCTCCGGTATCCCGTTACAAGACGCGTCTCGGCCCCCAGCC
GGGGGCCTCAATCAGTGTTTTGTCAATCCAAGTGAGAACTATCCATACATCTAGCTACGTAGGACCTATTTCAATGCATAGAAACCGGAAGAACATTCTA
CACATACCTTATCATAGGTCGAATCTCTGGAGTCGATACCAGTGCATCATACACTTCCAACGCTCCCCCTCGACGACATGATTGTAGACCGCTAGAGCAT
TCACCCGCCTGTGATCCTCACTGCTGCATCCTGTTCACTAGACATCTCAATTGAGGCTTGCCAACTGCGCTCCAGCCAACCTAGATGATACCGAGCGTTC
CAGGTGTCCCTGCTCCACCATCGTCCAGCATCATGTCACATCTTGACATCTTGTAGTCGTCGTTCGCCTTGTATGTAGTTTTCTCTTCTTCTTGACCACT
AATATACCCGTCACCACTTGACTTGACTCTTTCTTCGATAGCACTCGCGCATTTAGACCATCTCGCGTCACCACCTTTTCACAACACCCTTTCTACAGCA
CGCGCACCGTTAACAATCCATGCAGGTGAATTCTCCTGCGCCTTACTTGTACATCAAACGCCTTCTCTGGCGAATTGTACCTTGCACAAGTCGATCCTTA
GTGAGATGTCTGCAGCTGGACCTTGGGCTCATGACCTGTCGTCTGACTATGAAACGGTTCAGTTACGAGAAGAAAAAGTTGATACTGATTATTATCTTGT
CAAACTTCCGACCTGTCGACCTTTCCAATACCTTTTTAGCTCCTTTTCTCACATGCAATCGTGTCGGCTTCACTATACTGAAGTGACATCAGTAACAGCC
GCACTCATCATCCACGCAAAACTGACACATTCGTCAGTTGGAGCCATCTGTCTGAAATCACACGAACAGTCGCCCAGATGGTCAATTCCAACAGCTCCTA
CTCGTAGATACGTCTAAGTTTGCAGAGTCTCCAAATAGTAACGAAGCGTCAGTAAGTCGCCGTGCGCAGATCATTCGTACAACACATACCTGCTCTTTAA
TTGCAACCATGAATCATCTTTTTAAGAACATGCATCTTTTCGCACAACACATACCTGCTCTTTAATTGTAACCATGAATAAGCTTATTAGAAATACATCT
CGATTACTGCAGACAGATCGTTCATTAATCTTGACCTCCGCTTCTCCCCGGTAATGTCTTTTAATACATAAGCTTATAATGGAAGAATTCTCAAATTTCC
CGGTATGTTTTAAGGCTTGCAATCGGTTTTAATTGGGTCTTTTTGTCATTAATATGGGGATGGCCCCCCCCATTTTACTTCCGGGATTTTGGCATTGTTG
GGAATTCCCCCCCAATGGGGGGTAGAATTAAAAAATTGCCGGGGGCTATTGGGGGGGGCTTTTTCCTTTTCTAAAAACCCGGGTTAACCCGTCCATTACA
GGAACGGCTGCAAGGCCCCGGGAAATTAAACCCCCCCCAAGGGACGGGGGCTTTTTTTTTTGGTCCCCCAGGGACCACCTTTTAAAAAGATTTTTTTTTT
GGGGGGATCTAGCGGGTTTGCAAAAAAAAAAAANNNNNNNNNNGGTGGATTCTGGGGAGTAGATTCCCTCACATGGCCCGCTGCGAAGCGATCGGCAAAG
AATTTGTCAATCGCTAGTACTTGTTCACGCGGCAATGGCCATTGCTTCATGACACAGTACTCTGAACCTGGTTTCAGGTCGATCTCGTGACGAGAACCCT
TATCCTTAGGTAGCTCGCACGGCACTGTTTCTGGGAACACATCCCTGAATTCCGTCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCGCGATTG
AGATGTATATTACTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAGCCCTTTCGTTCTCAGCGAATACTATCGCCGAC
CGAACATCGGTTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGCAAGAACCTTTTCTGTTCGAGCGTGG
GCAACTGATTGATCTCCGACGTTGTCTTCGGAGGCGCGATCAGATCAAGTTGGTAAATGCCTATACGTGATCCGTCATTGACTAGGACACAATGACTCTG
TTTTCTCCTGGGAACTTATTTCCACAGTTGGGTAGGGACTTATTCCCTCACTAGCCTCTTTGGCTAAATCTTCATTTGACACGAGTGGAATCGGTGGTTG
CGCTACCACGGCCAGGTCTTTTACGTGCGATTCTCCAATCGCACTAAGATCATCGTATTGCCAATCATTGGCGAT