Description :
From Genome Similarity Track
Location :
Scaffold_71:5265- 7448
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_71-snap-gene-0.8M96 mating-specific protein family

Sequence
2183 bases(100 bases per row)
AGCAGTTACAGCAGAGAGCGCTTGCGCCCAAGCAGCAGCAGCCAGCCAGACAACTCAGTAGGAAGAAGAGCAAGGGCGCGCCGCACAAGTCCAACAAGGC
GCGCGACGGCCGCAAGGCGGAGATTCTGCTGCTGCGTAAGACCGTGTTTGAGCTCGAGAGCCGTCTCGACGGGCTCAAGAAGCAGACGAATGATGATCCC
GACGACGGCAATGGCTCGCGAGAACTCAGCAATTACTCCAATGGTGGCTACAGCAGATGGGGCGCGACCCAGTTTCAATTAACGCAGAACGACGACCCAG
ACGCCGAGCTGCAGAGCGCGTGGCGGGAGATTGCGCGCCGCCAGTGGAGTCAGCGGGACGCCAGCGAGCGCGAGAACAGTCGGCTGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGCTCGAGAGCCAACTCAAGGTCGCCAGGAGCCT
CGAGAAATTCCTGCTGCTCAAGGCCGCGTCCACCATGGTGCGTCTCTTTTTACTGTGGTACACTGTGTACCACTGTGGCTCACTTATGATGACTCTGGGC
ACGCTTTTCTACAGGAACTCTCGAGGAACGTGGACCTGCGAGGCCGCCACTATTACCGCATCCCGCGAGACAGCAGCCTCTCGAACGACCCGAGCGAGGC
TGAGATCTTCCAGGAGCTCTTCGCGGGTGTCGAGCAGTCGCTCGCCGAGGTGGACGCGATCTATGAGGCGAACGGCCTCGCGCGCATGGAGAAGACGCAG
ATGAGCGCCCGGATGCGCCTGGACCCGGCGACCGGCATGCTCGTCGAGGTGTGCGCTGCGAAAGTGCTGCCCTTTGGCGTCCGCGAGACTGGCGAGGCCG
TCTGGGGTCATTGCATGTTTGACAAGCAGAGCCTGCCATCGCGGTGCTACTCGTACCACGCCCACAAGGTATGTGTTGAGTGGCTAACATTATTGGGGTA
TTGTGAAATTGATCGCTCTAGCTAAATCTATAAACTGCGATGGTTTTGCAGGGCACCACTGGTGTGACAGAGGACACGATCGTTGAGGACTTTTCACTCG
AGCTCCACGCGAAGAACACGCACGCGAGCTTCCGCGTGCGCCAGGTCATGCGTCGCGTAGTTGAGGACGAGCGCATCGTGGTCGTCTGGCGCTCGTTTTT
CGACCCGACCGAGTTCTCGGAGCAGCAGCTCTCGCGCGTGCGGTTCCTCGAGAAAGGTTACATTGTCATCCGCAAGTCGTCGGCGTCATCGTCTTCTCTC
CAGAGACCGAGCGTCACGCTGCTGCAGCCGTGCTACATCATCTACCCGCACTCGACCACGACAGATGGCGGCAACCTCACGGACGAGAGCGACAGCGTCA
TCGACGCGATCGCGGAGTTCATGCTGAGCTCAACAGTGACGAACATCGCAGACTCGCACCAGATGGTCGAGAACATGCTGCTCGAGCAAGCACTTCGCCA
GCAGAGCAGACTCGACGCCCCATTCGCGATTCAAGATGCGACTGGCGCGGGCTTCTGACAGAGAAGACCTCTGAGGAGCCATGACGAGGGTGCCGGAAAG
GATAATCGAGAACAAATATGTGAAGATCAGGGTCAACTTGCGAGCAGCTCAATTTCGCCCAGCAGCTCAGATGCACCCAGAGGTGAGAAAAATTCCACCC
TAACCAACCAACTGGTGCTAGTGCTGAACACACCCATACCCACGCACCAATGTACCCAAGAGATCGCGGCATCATCCGATCAACCATCACTCACGAAAGT
GTAGCCAGTCCGATCCTGAGTGACAGTCTCACAAGTCTCGATTTTCTCGCTGCCATGTCTAGAGACACTGAAGATTTGATCATTCGCAGCTAGAGCCCAA
GCCAAGTCCAGCTAATGACCACCAGCAAGCGAAATGACGCCACAGAAACGCGTGAAGTCACTACCGCCGGTGTCGCGGTGCTGGGCTCTCGCGCGCTTTG
GGACGCCATCACGAGCTTCATGGATGGCTTCCCACTTGATGTGCTCCAGTTCTATAGCGAAAGCGACCCGACGATCCTAGAGA