Description :
From Genome Similarity Track
Location :
Scaffold_72:52643- 54682
Transcript NameFunction/comments
Phyca_LT1534127803Hypothetical protein
Phyca_LT1534510971PREDICTED: protein RKD3-like

Sequence
2039 bases(100 bases per row)
attggatcagctccccatacaagaccagagcggagatccacgtgacctacgacgctgagcatgctcgctacgaaggactgccagaggaatggcgaacact
caatcttcagtttggcttgccgcttgaacaggtccccaaacgcagggtggaagggtacgagaccaaattacctgctgtactggagatgatgaagacctgc
tttctagctcataacggagttcgtaccgaaggagtgttccgcctagcaccagaccaaaaagaatacaacgaggtcaaggccgcgatcaacgacggatcgt
tcgaggactgctccaacgtccacattatggcgtctctcatcaaggtaaaacgtcatcgtgggggggggggtacatccttgggtgtgactgatttcattgt
tattgtacaaccaggtttggtttcgagaattgcccgtaagcctttttaatatgctaccagagcagcagatcgctctcacgtgcgaattggtggtacgaag
ataacgagatcgttagtcagaacttgactaatcctaggtttctgtttgtatcataggatccagaccccaaggtcgttctacagtcattaaagacgttgcc
tgtactgcaccaaactgctgtgctgtggcttctggacttgctgaatgaagtcattaagcacgaacacgagaacaagatgaccgccaagagcatgggtccg
ttcgtcttttattctttttactagtgcgcaagtcgtatatctcactccttgctcgtgtctacccaccacagctatcgtcatagcgccgaacctgctgaca
gtcgagacctcagacgctgcagttgtcgtcaccacctaccgacaagttgctgactatgtgcaaatgttgctacgtgctcgattgcagtcaagatgacaaa
aatatactaaagtagcatgacaaagtcgtttttatcaagaataatttaaaccctatgcataaaaagaaaagtggaagcaaaaaggagactgaaagtggac
aatagctgactgtcgacacatctatccaagtactgagctcttgtgtatctacacgaggcagccgtactcaggggagatgtggcggaagatgtcgtcttcc
aggccttcgaggccgctcgttgtcgactcttccaaaccagaagagctccctgcaacaggctgctgagtcacggccgttgctttcctcatggccatagtgg
gcgatggctgcagagggaaaaagtcgtatgagacagcgtccagcgagtagccgcatgacgggtggtcgttctcgccgtaagggtccattgtggtggtgct
gagttcgccaaagggatcgtacatagcatcgaagacgaaggctggctgcaccgcaggcatcaaaccggcctgggcgtattggttgtactgcgctcggctg
tattctgcggctgcgttcatggcgatggcattgccgaagaataggttctcgcggtgcggcgaggaggccgaagctgaggacggcgagtctgtgaacaggt
gcttgcgagccttgttcctgtgtgcgaagtgctccacgcccggtcgggggctctgagacccacacgagtcctcatctgagtcgtggtcgtctcctccgtc
gacgtcgccctggaaaaaatgggcaggcagcatctggccgaaagggtcgatgccgtacgtctcaggcgataggagacgcttgagttggctctgatatcct
gcaaattggcgcatctgcttgtccgagaggggcgggcctgtgccgtcctgtgcctgttgctggcattgctccagctcctgcagcgagcgcttgaggctgc
gcaccttgcggtatggccagtggcggataccaattgcacggcagcgctttttgaaggctgtagcgcgaacaccgaacttctcggccgccactttgagtgg
tagatggaaatgacgactgagggccgcaaagttgcaggtggcgacgggtagtggcgatcctgagccgtcggaatctacgggcgaatcacaggccgtgcgt
ttcttgaagttgtgagcggccacctgcatccgtagcgac