Description :
From Genome Similarity Track
Location :
Scaffold_29:526409- 529511
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12075ubiquitin-specific protease
Phypa_INRA-310PPTG_12076hypothetical protein

Sequence
3102 bases(100 bases per row)
CGCTCCTGTCAACGGCGTGTATGTAAGCACGTCTCACGTCCACGACAACTGCTTGACTTACGCTTGTGTGAAGAGCGACATCGAGTACACGCTGTTCCGC
TGCTGCATGCCCAGTAAGGCTCGTCGCTGGTACATTTCATACTCTCCTAACAAGAACCTGCTCGGAACGATGTCGGACGAAGATTTCTACTTTGTTCAGT
CGCACATTGACGACGAGTCTCCACCGGTAGATGGTTGGAAGGTCTGGGTGAAGAACGAGAAGGCCAAACCGCCGGTGCCAACGGTGCGTCTCTACAGCTC
GACGGTGGCGGCTCTAGATGGGGAAGGAGACGCTGCAGATGCGTCGGACGCTGTGGAAGGCTTTATGACTGGAGGCGGCTTCGATGACGGCTCGAGTGCC
CCGACCGCGCCGTCGTCCGACATGGTCGTTGAGACTGTGGATGTAGACGCGGACGCAGAGACGGTGGAGTATGACGACAGCGAGGACGAAATCCGCGACA
GTAACGAGCGATTCCGAGCCGTGCATTTGGATACACAGGAAGACGGCAGCAGCGCGGACGACTTCATGTAAGCGAACTCGAGGAGAGTAACATTATGTAG
CCTTTTGCCACTCATCCCGGCTGCACGGCATAAACTCGAGTGCTGGGTGGGCCGGAGGGATTTCAGGTTGGCGAAGGGAGGTGCCTTTGTGCGGTGAAGA
TTGATAAAGAAAAACAAATTACCATTTTTACGTTGAAATCGCGGGTTGTTTCTGGCTTATCATGCAAGTAGTATTACCTGCATCGTTTCTTGCTGATCTG
CAGCTCGGTAAAGTTTTTTTTTTATTCAAATGTGAACAAATTTTCTACGTGATGAAGCTTGAAGTTGCTGCATGCCAAGATCAGAGCCCTTCTCTGCGTT
TCGATGAACGAACGAGCTCCTTCTCACAGGATGGCCTTGGCACGCGCTATCCATGTAGCTTTGCAGTTGAAGCAATAAACGCTTCACGGTTTACCACCTT
TTACCATTTTTTGCCATCTTTTGGCTCATCATTTGGGGCGCCTCCTCTTCATGGCCATGTGCACGACGAAGCTGACCAACGGACGACCTGCGCGGAGCCT
TGTCATGACACACGCAGGTTTTTGTCTCTCTCGTCCTCTTCAACTTTACCGAGTCCGTAACCGACCTCTACAAGCTCTTCGGCATCTGCTTTCCGAGATC
GCGAGGATATATCTGTAGCCACTTGATCAAACGCACACATTGTGATCCAGATCTCCGTATCCGCTGGTCATCGCCTCTTGTGCCATTCATTCGAACAGGA
ATGACCTACGCATGAGCCACATGGCATCATGGACGCCAACAAGGAGGATACCGTCGAACAAATGTATGCTAGCTCATAACTACACCTAGGTAACCACCAC
GAAGCCAGCAACGCACCGTCATAGGAACCCGGATCTGTATGGGCAGATCACGGGCAAATTTTGAAAGGCTTTTGAGTTCCCATGAAAAATAGGCCATTAT
TTGTCAAAATTTGCCAATTGCTGAGTGAAACATGACTTTTACGCAGGATGGACGGACTTGGATCGGTTGGGTGGGTTGGCACCTTGGAAAAAAGTTCACG
GGCAATCACCCTCGGCTTGCGTTACATCGGCCCGCCAGCACCATGGCGACTGGGTTTCGTCTCCACTGGTCGTGTCTCTGCTCGTCCTTCATGACACCAA
TGTGGCAGACAAGGCTAACCGATTGGGAAAACCAACCTTGAATCGTACATGAAACCAACACCGACATGATATAGGGAGCGCTTCACTCCAGCAGACACGA
AAGAATGCGATGGGTAGGGTCACCACAGCAGGACTTGCAAACCCCATAAACCAAGGTGAAGGTGTCAATGTAGGCAATCAACAAATGAATCCGCTTGGAC
GCCCTCCAAACACATCGGCGGCAGGACAACCGCAGCGAAGCCACCCCTTGCGACCGCATGACATCCTCGAGATGGTACCTGCATTGTCTGCTTACAGCGT
CAGCCCTGGGGCGTCGAGGCGGAGCCGCTGAAAAAAGTGTTCCCTCATCACGGGATCAAATTTAGAGATCGGACCAAGCCACTGGTGCTCGGCTTTTGCA
AGCGCAGAAAATTTGCCACCAGAAAGTGCCACTCGCACGTCCGCCAAGTCCGTGCATCGGACCAAACAAGCCCAGCCCTGGAGCAAGAGCGGGCTCCGGC
GCGGTGCAACCAGGACAGCCGACGCCCAGCTGGCTGCTCCGACCGGCTCCGCGGAATTTGTGCGGCGCCACGAACGTCGAACGCCCAGCAGTTGAAAGTT
ACAGATGAATCAAGCGTAGTCGCTCGCGTTGGTGTTTGTCTCGGGGTTATGCGGGTCTGGGAGCCCCGTCAAGTAATCGGCTTTTGTAGATTCAGCCCAA
CTTCACCCTAACTTGGAGATTTGGCTATGTCGGCAATGTTGTGATGTTGTACCTGAGCTCGTGCAACCGGACGATTTGCCACGTCTTTTAACGCCGGCGA
AAAAAACGGCTGCGACTCCGAGTCACGCAGAGCGAGGCGCCGCTGGAGCTCCAGAGCTCCGGAGCCTCCGCTCGGCCAGTAGCACAACGCATTTCACTGC
CATCGTCACAGGTCCCTGAGCCCCCAGAACTTCGTTGAAAACCAGCAGCTATCGCCCCAGAAGTCACTGGAAAGACACACTGCACCACCAAACAACGCAG
TGAATCAAGCCTCACTTCGTGGAAAAGACCGACCCAGTTTCGTTCGCGCACATCAACAGCTCGCCACAGTTACAGCCACCGGTACTAAAGCGCCCAACAC
TCCTCCGCGTCCGTCCTCCCCATCTGCACTTTCGGATTCGCCTACTCTCACACAGACCGACTGAACTCTACCAAAGTCTTGTCTGCGCCGGTCAACCAAG
CACCAACTCGAAACTTCCGCTGCAGTCTCGTCTCGACTGCAAGTAACACCAAGAAACCTCTACTCCTAGCAACCGATGGCGACTCAAATGGACCAGCTCC
CGCAAGTGCCGCCCCCGGGCACCAGTCCGCGCTCCAGTAACTCGTGGAGTCGCTGCGACCAGGCTGTAGCTCGTATTGCCCCCATTGCCACCACCACGTG
CC