Description :
From Genome Similarity Track
Location :
Scaffold_1120:5263- 10404
Transcript NameFunction/comments
Phyag_g9565hypothetical protein
Phyag_g9566secreted RxLR effector peptide protein, putative

Sequence
5141 bases(100 bases per row)
CGATGGgtgatctccatcgtcatccCGAAGCGACACCTCCACGGTAGTGCTTTCCCACGCAACAAATCTCCAGCCGTTTGGGAGTGATATAGTGACCCAC
CACTTGCTCTTACGGGTGAAAGGATCCTCCTCGCCCAAGTTATAAAACGCTCCGATAATGTCTCCAGCCAGTAGTGTAAATGTTGCCTCAGCAACGCTGT
TTGGAGTGACTGTCGATGTCGAGACCTTGTACGAGTCCGTCGACACACATGTCTTGTATCCCGACGGGCATGATCCATCGGAAAGCTTGCTTTCACAGGT
TGATCCGCTTGACTCACCAGGGTACTGGTTCTGGCATTCTGTGGCCTTACACCGGCAGTATGTTGAGGTGTACGGCTCATAATAGCCACTGCCATTCCAC
TGAATAGAAAACAAAACACGCCACAAGTTAGCACCACGCACATCTGGCACAGACGCGATGAAGTACGACGTACCCAGTATCTGCTTCCGCTCGCTGATTC
AGATTCGCTCGAAGAACTGTTGCTAGCTGTGAGCGAGAAAACCTTGATCGTTTCTTCTGACCCACTGTGTGATCCTGGAGTTGTAGAATTCGCAGGCGCA
GGTGTTTCCGACGACACCGCTGGTTCGTCCAGAAAGGCTGTCGAATTGCCCGGAAGCGCAGGTGAGGGAGTTTCCTCGACCACCGAAGTGTTGGAGCTAG
GTGCTGACGTTCCTTCAAGAATGTTCGATCGTTCCTCTGCATATCCAGAAGACGCAGCCCGGGTAGCAGACGCGCTGTCATCAATGGATCCAACGACAAC
CTGTGCGCCGCCAGAGCCTCCTGACACATCCACACCTGAAGAGCTGGCACCAATCTGAGCACCACCAGAGCCAATAGACGTGTCGATATCTGGAGAAATC
GTACTAGCTTCAAAGTGAACATCCTGAGATCCAACCGAAACATCGGTCTCTGAGGAGCTGGCGGCAATATGAGCACCGTGGGAGCCTACAGAAGCGTCAA
TATCGGACGAGCTAGCGATGTGGACACCATCAGACCCAGCTGGCACGCCAATCGTTTCAGGGATGCCGTGAATGTGTAACCCATGATAACCAACAGTGGC
GTCAATATCGCTCGACCCCACAGTGCCATCAATTCCACCGGAACCAACCGATACATCCAAGTCATGGGATCCAACCGAGGAGTCTAAGCCATGTGGTCCC
ATCGAGATCCCCAGCCCAGAGCCCACCGTCGCGTCGACCCCACCAGATCCTACTGAAACACCCAAACCAGAGCCTACCGTCGCATCGATTCCTCCAGATC
CGACCGAAACGCCAAGCCCAGTCGATCCTGTGCCTACCGACACATCAACACCTGCAGATCCCACTGAAACACCCGCTGAACCTGCCGAGACGTCGATGCC
TCCAGAGCccacaacaacaccaaccgATCCGATAGAGATCTCCAATCCGTCACCGCCTATAATGATGCCAAGCACGGCATCCTCATTCTCCGCTGAGCCT
GACCCTGAATCTGCGCCATTGACATCATCCCGACTACAGTCCTCTTCCGACTGCGACTGTGACTGTGGGAACGCAATCGTCTCTGCATCTCCTGCACTCC
CCGAGCATTccgaagagctcgaacgTCCTTGTCCGTCGAATACATTCAGCAGTCCATCCGCCTCCCCCTGCACGTTCTGCTCCACGGGGCTTCGTCCATC
CTCTGCAATATCTCCCCTGGCAACCCTCGTCACTTGCTCAAACTGCGGCTCTATCGCAGACTTTGCCAAGCTCTCGAAGTCTCAAGTGACACAGATCATG
GTGCTGGAtatggcggtggtggcgctacTCACTCCGCGTTCGTGCCGCAAATTGTTGAGAATGGAGAGGGGAGTGCTAAATATTGGTCTCATCGAGGAGC
CTATCCTATCGCCGTCGGCTGCACTGTTCAGTAGTACCAAGGCATTCGCTATCAGGGACTTGGTTTCAACTTTAGTCAGGGACTTGGCTACGAACTGGGG
ATCACCGACACGTGCTACTGTCCTGGTCCAGTACACACCGACTTCAGTAGTACTGCATTGCAACGACGCAATCTACATAGACATCCCGCCGAAACACTGT
GCGGCTCTGGCATTGCAGGCGATGTTTCGTGGCCAAACGTTGGCGTACGATACGTGGTTCGCCTACATCTCGGCATTTCTGGGAGCATGCGTGTCCCCGA
GACGTCTTCTAGCTGGGATCTGCGCTGTGTGCATGAATCCACCGAGCAAAGTGATGCAGATGCTTCGTTGTTGAAATGGAGATTGAGCTAACTGTGATCG
TTATGTATTGCCCACACATGCAATAGcgtcgaagacgacggaagGAGACAGAAACTTCAGAGCTGGTTCGCTGGCTTCAGGCAATAGAGAGCGTGATGGT
GTTAGCACCCGACATAAGAGGGGACGACAGAATGGCACACTCGTACAGCTTGTAGTTAGTCACAGTCGCGGGTCAGCACCGCCACGAAGACAGGGAGGTT
AGGAGTAAACTCGTCCTTCACAGCGATCTGGGAGCGAGCACTGGCTGAGCGAGCGTCAAACCAAACTTTAGCATCCTGGCCTCCCCGGGATGAGCATCCG
TCAAGGTGAAGGTGATCTTGATACCGTCGTTGGCAGCTCGTCGGAACCAGCCCCAAACTTGATCGGCTCCTATACAGACATCGAGGTCGCTCGGGTGCAT
AGAGTAATCTTATCGGCGTTCAGAAAGCCGTAGGGCGAAGCACGGCCGGGGGGGAATCGCATACACCATGCTCATGTGCGCGACACCGTTGTCTATGGCG
ACCCCCAGCTCCATTTCCAGCCGTCACTGCTCGTACTCTCGCTGCAGAGTGGTGCTGCGTGCCATATATGGCGGCGTTCCCATATCATCGATCGACGAAT
TCAGCAACCCCAGCGTACTAGAACTACGGATGTGCACGAGAACCTTCTGGTTGATTACATTATTCTAGACGAACCAACGCGTTCCAACGACAAACACACT
TGTGAGTAGCCACAGATCTTCAGCCCAGCCTTTTCGGATTGATGTTCAAGACGTGTTATGCCGCATATAACTTCTGCGCTACACGCAGCTTTGTCACAGC
AACAAATATTGCTGTTTCCAGCCTGCTTAGTATAGCTTGCCCTCCACCAGCTGCCTCCTTTTTATTCAAGCTGGTACGCACTGAGGGAGAAATTGCTCAT
AAAAGTTAAGTGTCGTCTGGTATCCGTGGCCCCATCTTTTACAACTCATGTACAATTTTGAGGAAAAACTATCAGACGATTGGGGTCTCTCGATAGTGAT
CCAGTGATGAAAGGTAGCGACGGCAAGGTTAACCTTGGATTTTACGGTATCGGTACTGCCCGTGGTAATTTACCTCTAGGATTACTCCAGCAGTGGACTG
GCCGGCCTGCAACACTTGCACATCCGTAGTTCTAGCaagctgtcgttgctgaatTCGCGATTAACGATGGCGTGCCTACTTCGCCCTATAAGCTTATCTC
ACATACAAAGTAAGAATTGTCGATACATCAAGCGATACAATTACGCAATTGCGGCCACATTATGTAACCAATCTGTAGAAACTCTACACATTGTAGTGCA
TTACAACTTTCAAGCTTGACGCGAACGACTTAGGTGCGCCTTGAACGCTATAGTTGCAGTCACCAGATATAACACGCATATCTTCGTAAGATTTACTGAA
GAAATTCGAGAACATCCACAGTTTTTGAAGATAAGATCTTCGTTTCTATCCTCGCCTGACTTAAAGTCAGTGACTTTGCGGACAGCAAAGAACAAATCCA
GTCTCTAGAATCTCAAAAAGCACTCCTTCGGATTGAAGGATCAGAGATGCGCGTCCCAAGCGAATCTTCCGATTATCGTGTTGTAGCCAGTTAAATTGAA
TCAACACAAGTTGATAAAGGCTTTGCCACAGATCCAGCAGTAGGACAGTGCGAAACAGCAAAGACCAAGGTGCTGCTATACTTGTCTGAAGAAGTTGGTA
GCATTTCGTAGCAGCACCTTCCGCTGAATAAGTATAGCTTCGAAGCTACTACACTACTTTTGTATCTAAGTGCAACACAGTGTACCAGTAGATAGCAAAA
TAAAAATGATTTGTGTAATGAAGATTATTTTGTCTAGAACCTACAATATGTGTATTCGTTACGATACGTGGTATTGACTCTTCCTGAACTCTTTACTGCA
TCAAGGTACATTTCGCCTTTGTTCGTTGTCAAAGCAGCATCTTGACCTTTGCTGTTGCGCAGACGCATATGGCTATCCTACGATCCTCGTTGTCAACTTG
TGTTAACTCAGCCAATTTGATTGGCCACAATGGCTCGTTGAACGAGACTTTCACAAGATTGGCTTGGTGACGCACATCCCGATCCAAGTCGGCACACCAC
CATCAATCGCGAATTCAGCAACCCCAGCGTACTAGAACTACGGATGTGCACGAGAACCTTCTGGTTGATTACATTATTCTAGACGAACCAACGCGTTCCA
ACGACAAACACACTTGTGAGTAGCCACAGATCTTCAGCCCAGCCTTTTCGGATTGACGTTCAAGACGTGTTATGCCGCATATAACTTCTGCGCTACACGC
AGCTTTGTCACAGCAACAAATATTGCTGTTTCCAGCCTGCTTAGTATAGCTTGCCCTCCACCAGCTGCCTCCTTTTTATTCAAGCTGGTACGCACTGAGG
GAGAAATTACTCATAAACAGTGTTGTATCGCGTGCTTCTACTTTATGATTTGCAGCAGAATTTGTTGCCAGACTGAACCATGCGTTGACATCACATTTCG
TGTTTACGACTCACGGCTCTCAGGCGTCATGAGAGTGCGATTCGTGCTTTGACGCGTCGATACACTCTATTGATGCCATCCACCCTCACTTTGAAATTTG
CTTCTCGACGCTCAAGTACACTCCGAAAAACGACCGCATCCATGCGTCTATCTCACGTCTTGGTGGTGATTGCGGCCACTTCCCTAGTTGCCAGCGAGGC
ATTGAAGACCACGGACTCGAACCAGATCTCcgatgctgcttcacctACCGGCCACAAGCAGCGCTTTCTGAGAGTCGACCCCACGATcattgaagacgac
gatgattcGGAAGAGAGAGCTCTGTCTGAGTCAAAAATGAA