Description :
From Genome Similarity Track
Location :
Scaffold_590:5263- 8746
Sequence
3483 bases(100 bases per row)
TGGACTGTCTGGGGTAAGCTCTGTTGCGCGCCATTGATCACTTTCCACATGCAGCAATGTCATTTACGCATCCTCTGCTGCCATAAATCACGTAAAATAT
GTTGTTGCATGGCCCTCGTCGGTCAATACTACGACATGTTACTCATATACAGTAGCTGCTAGGATTGCGCAGTCTGGACTAGTCGTCTAGTTGGCTTGCG
GCGCAAGCTTACCTTTTTTTGCCACTCAAGTCGCACTCAACTGCAGCCACATCAACACCAAGAATCCTTTGCCAATATTAGCCTTGTTGACCTAAAGTTC
CAATATGATCTGTATCACGTATCACTTTTAAAAACATTGTGGTATGTGGTGGGGCGTACAATAATGGGGTGGATTTAGTAATAGGTGTGGTTAATTTAAC
AATTTTCTAAAATAAATCTCCTCAATAAGGCAACATTAGTAATTCCACTCGAGAGCGCTTAGTAGATTTTGTATCACCTGACGTCGTCTAAATGACCTCT
CAAATATGACGCGTCCAGCGTCACGATGTCAGCGGAGCAAAAATATATGGGTTTTGTGTAAGATGTGATACAAAAACGAAAATTTTGCAAGATGTGCTAC
AAGGTATTTTATAAAAGGAAATAATATTTAAATAACAACGACCGAAATGATAGCTATCATAAAGGCCCAATTTACTGTATGTTTGATCAAGTATAGGTGG
GGCACATCTCACTATTCGCATATGATTCCACACGAGAAGACGGGGGAGGCGCTTACTGCTGCAGAATACACTGCGAGTTCATTAGCGGGTTAGAAGTGAC
GTATGGCAACGCACTAGCAGCGGGCGGAGGCTTTCACCGCGCTGAGGGTGTGGCAGCTGAGGTGTCGCCCCACACATATCTCTAATACAAACTCTCATCG
CCGACTCCGAAGACGGCATATTCTAAGTCTGATTCGATTCTGAGTGATCACGCAGATTTGTATTGTCAACGAACGAGAGGGCGAGTGGATCAAGCTGGAC
AAGTCGATCGATCGACCGAATGGACGCTTTCTATGGTTTCAAGTGACACAATTGAAGGCCTCGACGTCGCCACCAGCACAGAATAAACAGCAGCTTATGC
TATTGAAAGAAATCTGCGTCGTACGGGATGTGAAGGACCTTCCGGAAGGCTTTGAGGCGCTCAATGAGCCACTTGTGAGCGCTGGGGACGGTTGCATGTG
TGACTAGAAGAGCTGCAGTCGTATTTACGTGTCCGCCGACTTGCAAGTGAGGACTTTTCCGACTCGAAGTGGTCGAATATGAATCAAAAAGTAGGCGACT
GGATCGATGTCAAGGACCTGTCGTCCAACAAGTTGAGCGTGACGCAGATTATGCACATGTCGCCGGCGTACCCGTTCTTACGCAAGCAAGCAAGTCAGTG
GGATGCCAATATGAAGGACTTGCAACTCGCCCGGAAAAAGTTTGACAAGTACTTTTACGACCGTGACAAGCAATAGGCGTATCTGCTGCGATTGCTTGTG
CCGTTTATTGAGAAGTCGTTGCCGCATTTACTTCTGCTCGGCGCCTTAAACTACTTTAATATATGCAACGTGTGATGTATCTTGAAGTTTGAATTCAACT
ACATTCATTTTAAACCATAAACTTGCATTAAGGTGATCCATCTCGGTACTTTAACGTCAATAACAGCGGCATGTAGCCTTGTTGTGTCCTGATGTACTAC
ACCGCTTACATTTGTAAGGCTTCCTTGCTTTCCCGCCAGACTCACCCTGTGACCTGATACGTCTTTTCTTCGGGCATCCGGCTTGTCGAATATAAACTGC
GGGTAGGATATTTAAATCACGCTCAAACACGTGGTCCTCAGCAACCTCAAGCGTACCGACGCTAGCTTGATACGCCGCAACATTGTAACAGTTACCCATC
AGCTCGTACGCAATCTTAGGCTTATCTACCGCTCTTATGGTCGCGATCAAATGGCGGCACGATATTTTGTGCTGCTTCCATGTTTCACATGAGCATGATT
CTTTCTTGGTGTCGACAGGTGTTGCTTCAGTTGATTGCTGAATCGAGCGAAGAATGCTACGTTATCAGAACTGAACGTCACATCATATCCTGCAGCATCC
ATGACCATTTTCTGCAACTTTTGTTCATCCCGAGGCGTAACTGTACGTCCCTGTTTCCTCCATAGCATGCCCAATTGAAACCGTCTATAACACTCATCCA
TCATAATCGTCGTATAAGCCTTGAAGAACTCGTACGGCATCATAAGCCGTGGCTTCAAGCGGAGACTCTTTGCTTGCTCACTCTCAACAAATTGGTCGTT
CGCCATCCGTAAAGTAGAGTTGCGTCGTAGTGTACGTGAAGTGTCCACTTATGAAGCGGTATCTCATTTAAAATATAGCAGCAGCCGGGTCGATCGCTTG
TAGTTTGATCATCGTATTATCGAAATCTGATCGACGTGACGCAGCCTTCGCTTCCCATACGAGTTTCTCTTGGGTGACCAATAGTCGTACCATTTTGTCA
TTTCTCATATTACCTGTGCAGAAATATAAGACAAATTAGAACGAAGCTGCTGATAATTCGACTGTTTCCGTACCTATATTGTGACGAATGCAGAACATGT
TAAATATGTTGAGCTTTTCAGCGGCAGATACCAGGTCAGCATTTCTATCACTGAAGATGGGACTAGTAGTCAGTGGGAAAAGATAATTTAGAACACGGCA
AAAAAACCACGAGTAATTATCGTAGTCTTAAACAGGGACGAGCGCAATTGCAGCAATTTTCTTACTAAAATTTCTGTCGTGACTGGCTAATACAATCTGA
ACCCCGTTGTATTTGCGATGTTTCATGTGAGCAGCATCAACACCAAAAATCCCTTGGTCATTTAAAAACCACTTCGGGTTTAGTACAACGACTGCCTGGT
GGAAGTGCCTCTTCACGTCACACTGGAGCTCCGTAAGTGTTCCTGGGTTCAGACGCTGAAATTCCGACAGTAGACTTGGTAAAAGAGTAATCTTCGTTGA
ATCTTCTGAAAACAGCTCTATGTATCGTGTCCTTGGCACGATACATCACATGATAGGACGCCGTCATCTTGGCTTGGTGACGAAGTTGATATAGTAAAAG
TCTTGCTGACGTGGTCGGTTCTGCAGACAATGGACTACGGACTATAGAGCCGGCGACTAGTTGAGCCGTCGAAGGCTTCCCGACACTAACGCAATTCTGG
TGATCCAGATTTCCACCCGTCACATGCCTATCACCTGGGCCAAGTTTGTTCCTGTATCGTGCCAACCGAATATGCCATTCGCAGCCCGAGTTCGCACTGT
TCCACTGTAATAAACGATATGTCTCACCTCTCGTAGACACGACAGCGCATTTACCTTGCGCGAGTGCAACATCTTTAAGTGCTTGGACAGTTGCCATTCC
CGTAGTCCAACTTCTTGCCTTCAAGTCCTCCGTCAATTCTCTTTACGTTGGTGCAGGAATGAGCAAACTAAATTAGGAACATG