Description :
From Genome Similarity Track
Location :
Scaffold_688:5263- 6691
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_688-fgenesh-gene-0.4Protein SAMHD1 homolog

Sequence
1428 bases(100 bases per row)
GCAGCAGATACTCATCGATGAATGCGTACAGTTGGCGACGACGCACGCGCTGGATGATGCCGCGCGCTTCAGCGAGCGTCGGCGACTTGGATGCCTCAAT
CGTCTGAAAGAATCATGATATTGATAACAATGGTCAGAGGGCTTGGCGATATGTAAAGGGCAATACAAGACTCACGTGGACGATGTGATCTGTGAGGAAT
tGGAACTCTTCGGGGGACTGCGTCGCTGCTGAGATGCCGAGCTCTTTGTCTGTTCCGTGATAGCACGAATGTGAGCGATACAGGGAGAGAGATCTGAACG
AGCACTGAACAGTATCGTATCGTACCAGCTGAGACCATGGCGTCGCACATCATGAACTCGATGGCCTTGCCCTTGCGGTGGTTGTAGATCTGCTTGTGCA
TCTGGTAGCGCTGCTGAAACaGATCGTAGATGTCGTGtGTGACGGACGAGTGGTAGCAGATCTGATCGTCGATCACGCGGTTGAACATCCAGAGACGGGA
GAAGTTGAATGTCTTCTTGACGCCGAACAGGTTGAGCATATCACGAGCGAGGTAGTCGTACTTGTCCACATCGATGCAGTTGCGGCCGTTTGCGACGATC
TCGTACAGGCAGCCGTGGCGGCTCAGACGCgTTTCGCCCTTGTGAGCCCTATGGTTAATCGTCATCATCCATGATCAGCACTTCTAATACCATCTCATGT
TCCTCTCTCTTTTCCAGACGCACTCTTTGGCTCCGACGATGAGTTGCTGTACGAAGCGCAcATCCTGGCGCTCGAGATCAATGTGATTGTCGTCCATGAG
GTACTCGACCATGCGCAGCGACATCTCTTCGTGGTTGTACGTCGAACCAGGCACGACACGAGGCATGAACTCATTATCGAAGACATGGGAAAATGGCCCA
TGGCCGaTGTCGTGCAGCAGACCCGcAGCGCTCTATaCAAACAGCACACACAGTACAATTAGCACAGAgCCCTcATACGCCCAGGCTCTTCCAgTCGTGg
aCGTACCACGAGATACGAGTCGCGCTTGGAGAGGTTGAGCTCCGGCTGCGTCATGCGGAAGCGCTCGACAGTCTCACCAGCGAGATAGCCGACGCCCAGC
GAGTGCTCGAAGCGGTTGTGCGCGCCGCCAGGGAACACaTAGTAGAGTGTGCCGAGCTGCTTGAGGTCACGCAGGCGCTGGAACTGCGGCGTGTCCATGA
GCTTGACGCAGAGGCTATTGAGTTTGATGTAGCCATGCACTTGGTCTACACGCAGCCGTATCAGAGAGGCATGCAATAGATACAGAGaTgaCGGTGCATG
TAGTGGTACGCACCATTGATGAGCTTCGGGCGTTCGTCGTcGAAGAGCTCCATGGcGGCGGCGTCAGGCGAGGAGGTGTGCCGCTATGAcgCccATtCAT
GGTCACCTGTCACattACCAGGTGGAGA