Description :
From Genome Similarity Track
Location :
contig_42:526267- 532069
Transcript NameFunction/comments
g9132.t1OWZ08386.1 hypothetical protein PHMEG_00019085 [Phytophthora megakarya
g9133.t1hypothetical protein
g9134.t1RAW43160.1 hypothetical protein PC110_g642 [Phytophthora cactorum
g9135.t1POM66275.1 2OG-Fe(II) oxygenase superfamily protein [Phytophthora palmivora var. palmivora

Sequence
5802 bases(100 bases per row)
GCAATGACGAGATGGACGTTATGGCCCAATTGGCCTCGCAGTACTACGCGTCCAGCCGCAATCGCTCGTTCTCGGCGCCCATCCAGCCGTCGGCTCTGGG
CTCGGCCTGGAATTCCTTCGCAGATGACACGTCCGTGTCAGCCGCGGCCGCTGTGGCCGCCACGCAGCGCCACCATCAGATGCAGATGCAGATGCAGAAT
CAGAACTTGCGGCCGCATCAGCCACCGCTTCCGCAGGGTCCGCCGCCTCCGGTGCTCAACATTATGGTGCCGCCACCTCCGCCTAGTGACGAGGTCGCTG
TCGGAGCTATTGGCCAGGCCGTGCAGTCGTTGAGCCTGTCGAGCGAGACGGAGACCAGCGACGCAGGACTTCACGTGGACACTACAGGGGACGCCATGGG
CGCTCCGTTGCCGGCCACATTCCTCCGCACGATCTGCGACCAATTGGAGTACTACTTCTGCGACGAGAACTTGCTGGGAGACCTCTTTCTGTTGAAGAAC
ATGAACATGGACGGATACGTCAAGTTGGACCTGCTGGCGTCGTTCGGCCGCGTGAAAAAGCTGTCGACCGATATGGACCAGATCAAGAAAGCGCTGGAGC
TTTCGACCAAGCTGCTGCTAAATGAGGACGAGTCCATGGTCTGTCGCAAGGAGCCGCTGGCGCCCAACCAGACCTACCACGGCAAATTGGCCCGCACGGC
CATTGCGTACAACTTGCCGGAAGACGCGTCGGTCGCGTCGCTGCGCGAGACGTTCCAGGGCTGCGGCGAGATCTCGTACTTACGCCTGTTGAAGAAGAAC
ACGACCACGGGTCGCAATGCCGTGCTGAAGCCCCCCATCGCGGCGGGCGAGACGTACGCTATCATCGAGTTCGTGGACGACGAGATGACCAAGCACGCCG
TGTTGACACTGTCGGACCAGTATAATTGGCGCACAGGGATGCAGGTGGTGCTCTTTGATGGCACGAACTGCGACAAGCTCAAGCAGAAGATGTTCCCTGT
GGAGCTCGGCGGTGATCGCCGTCGTGCGAAGTCGGCGTCCGCTCTCACGCGCCCCGTGCACGTGGAATCGGTCGGCGAAGGGCTGGACGACCTCCGTGAA
GGTAAGGTGAACACGGGTACGGTGTACTCGATCCGAGGCGCGGGTGGACTCATTACGCCGACGCGACAGGATTCAGCCTGTATCTCGTTCCGCCTTATCC
CGGATGAAGATGGCAACATAGACATCAGGCAGGGCGACTACGTGTCGTTCACAGTGGGGAAGAACAAGAAGAGCGGCCGCAAGTACGCCAGCAAGGTCAA
GCTGGAATTCCGCCCGCCGTCGAATCTGACAGGCGATGCCAACAACAACGCCGGTGGCCTGAGCGGCCTGGCAGCGCTGAGTGGAGGCTCATCAAGTGGA
AATGGGCAGAAGGACTACTTCGCTCCGTCGCCGAGTCGATGGGAGTCGCGTAGTCGCGCAGCAACGGTGGGCGCTCCACCCCAGCCGGGCGCCTTCCGTA
CTCGTTCGTCGTCGTCGGGCACGCGGCCGAAGTTGAACTTGTCGTCGCCACGGATGGCGCAGTCACCTGTACACAACAACAACACCAGTAACCTCGGGGG
TAACGCGTTGGCGCCTCCTCCTGGAATGGGACTCAACGGCAGCAACCAGCTGTACCGCCAGGCCATTGGGCCGGACGGCACGCGGGGCTTTGGCTTCCGT
CGTACCGGTGGTGAGGCACCGGAGATCGCACCGGAACTCAAGTTCCGGTGATGGAGCGTCGGAGATCGCGCTCGTCGGGCGGTGCCTGGTAGACGGATGA
TGGAGGGCACTGACGAAGAGAGAGCACCACCCAAGGCTACTCTCATGTCGAAACACACGCTGGTACGAGCGTGATATGCTGGAAAATGACGAAGAATGAC
GAGAAACACTGAGAATTAGGCGCTAGCAAGACAGAAACGAAGATGCGATTCGACGCGAGACAAAAAATCAAAAAGAGCACACGAAATGCACAGTTGATAG
GAAGATAAGGAGGGCAGACACCAGGAAGCACGAACGAAAATGTATTGAGTGTGAGAACCCCCTTCAAAGTACCCAGTCTCCCGATCTACGTGGCCTACGC
GTTGGCAACGTCTACGGGGCCGTGGATCTTGAAGTCGCCGATCTGGTTCTCCTTGCCATCGTCGGCGTAGTTGCCCTGGACGCGCTTCAAAAGAAACTCG
CGCCAACTAAATGGACGGTAGTTGGCCAGCTCTCCTTCCTTCACCACGATGGGCTCCACCTGGACATCATACGCCGGCAAATAGAAGAACGGAGCCGAGA
ATCGGCCAGCCTTGTTGCTTGCCAGCACGCGGTGCAGTGGGGCCATGAACTTGTCGTTCGACCACACTTGCACCATATCACCAATGTTGATAGTGTAAGT
GCCCTTACGCGGCGGCACATTGACCCACGTCTGCGACTTTCGATGCAGCACCTGCAGAGACTGCCACCTCGTCATCCTGCAACAACACCGCAAGTGCACC
GGGGTCCGTGTGGTGGTAGACGCCCATAGTCTTCTCCGGCTCGGGGGCCACAGGGTAGTAGTTGAGACGCATCAAGCTCGTGCTGTCTTCGTGGAAGAAC
TGGTCGAAGAACGCAGGCTCTTCGCCCAACGCCACTGCAAAGACCTTCAGCAGGCGACGAGAAACAAGCTCCATCTTGCTGAAATACGCCCTCATCTCGC
TGCGAAATCCAGGTAGCGTCGTCTCCTCGAGCCACTGGTTGTGGTCATCTCCCATCCGTTCATGATCGTTGGTCACCGGGCCATCTTCGTTGGGCACGGA
GAAGTCGAAGCACTGCTTCCAGTCCGTTTTGTTCTTGGTGAGTTCGTCTCGACGAAGCCACGGGCGTTGTTAGCAGTACGTGGGATGGTGCGCTTGACCT
CAGTCGGTAGGCGGAAGAAGGAGCGCATGGTCTCCTGGAACTTGTCGACCTCATTTTGCGGTAGTCCATGGTTGGCGATGTAGAAGAACCCCCACTCGCT
GGCAGCAGTGCGCACTTCCTCGATAATCTGACGCAGCTCCGGGCTTTTTACGCCACGCAGAGCAGCGTTTGCCTCAGCGTCGGTGGGGAACGCCACGAGG
GCTCCGACGTCGACAACAGGTACTTGGTGCACGTTCATCTTCGTCTCGAGCTTGCAATTTTCGGAATGCATGGCCTACACTCAGCTCAGCAGAGACAGCA
GAGATCTTGCTTGGGCTCTGACGCTGCTTCAGTGGAAAGAGCCATTGGCGCGTGAAGCAAAGTGCGTGTCACCAAGGACATCATGCCGTACGTTATCAGG
TTCTATCCATGGAAGATAGTGGACCAGAACCCCATAGACAACGTTGGCAGCACCAACTTACGTTGTTTGGACTAGCCAACTACGCGTTCTCTATGGCAAA
CGCAACAAAGCAGCACTCTGGTGAGATAGGGATACGCCCCTCGAAGCAGAAATCACTGTCTTTTTATTGTTTGCTTGAATTTGGTCTGCTTGTCAGACCA
ACCTACGCGTTCGCAACGTCAATGGGGCCATGGGTCTTGAAGTCACCGATCTGGTTCTCCTTGCCCACATCGGCGTAGTTGCCTTGGTAGCGCGCCAACT
GGAACTGGCGCCAGTTGAACGGACGGTAGTTGGCCACTTCGCCTTCCTTCACCACGATGGGCTCCACCGTCACGTGGTTCGACGGGTTGTAGAAGAACGG
GGCCGAGAAGCGGCCTGCCTTGTCACTAGCCACCACGCGGTGCAGTGGCGCCACGAACTTGTCATTCGACCACACTTGCACCATGTCACCAATGTTAATG
GTGTACGTACCCTTGCGCGGCGGCACATTGACCCAGGTTTGAGATTCCCGGTGAAGTACCTGCAGCGATGCGACGTCATCGTCCTGGAGCAGAACAGTAA
GTGCACCGAAATCAGTGTGTGGTAAACGCCCATGGTCTTCTCTGGTTCAGGAGCCACAGGGTAGTGATTCAACCGTAGCAGACTCGAGTGGTTTCCTTCG
TAAAACTTGTCGAAGAATGCAGGCTCCTCGCCCAACGCCACGGCGAACACCTTCAGCAAGCGGCGAGCAATGAGCTCCACCTTCTTGTAGTACGTTTGCA
TCTCGTGGCGGAACCCAGGCAGCGCTGCCTCATCGAGCCACTGGTTTTGGTCTTCACCCAGCCGCTCGATCTTGTCCGTTGGGGGACCATCTTCATGGGC
ACCAGCAAAGTCAAAGCACTCCTTCCAGTCCGTCTTGTTCTTGGTGAGCTCGCCCACGACATAGCCACGGTTGTTGTTGGAGTACGGAGAATGGAGCGCT
TGGTCTCGACAGGCAGGCGGAAGAAAGAGCGCATGGACTCTTGGAACTCGTCGATTTCTTGTTGCGGCAGACCGTGGTTGGCGACGTAGAAGAACCCCCA
CTCACTCGCAGCAGCGCGGATCTCTTCAACTAGGTGGCCAAGCGCAGCACTCTTGGCTTCACGCAGTGCAGCGTCGACCTCGACGTCGGTGGGGAACGCC
GTGAGCGCTCCAATGTTGACGACAGGTACTTGACGAACGTCCATCTTGGCCTTGAGCTTGCAAATCTCGGAATGAACTTTGGTCTGCCTATTAACGTGCC
ACGGGAGGGTGGCGTTGAGGCTCTAGCGAGGGCCTTACGCTTCTTGCATGACAAGCTCTGAAGTCTTGACGCTGCTTTCATAGGAAAAGTGATTGGCCGG
TTCAAGATACCCTCGAAGTGCTGCCAGTAACACGCTTACGTTATCGAATTGTATACGATTCGTCCAGCTGCCCTGCATGGCGCCTGCTGCTTTCTTTTTT
AACTTTATCCACACGATGAACTTCTTCTCGACGATTCTTTTTGTTAACTCCTTGGTCATGTTATCATGATGCTTTCTTGAAAACTTCACTCGTCGTCTAC
GAGTTAGCAACGTCGATAGTGCCGTGGATCTTGTAGTCGCCGATCTGGTTCTCCTTGCCAAAGTCGGCGTAGTTGCCTTTATAGCGCTGTCCACGGAACT
CGCGCCAACTTATCGGGCGATAGTTGGCCACTTCACCGGCCTTCACCACAATAGGCTCCACCTGGACATTGTACGACGGGCCATAGAAGAATGGGACCGA
GAACCGACCAGCCTTGTTGCTCGCCAGCACGCGGTGCAGTGGAGCCATGAACTTGTCGTTCGACCACACCTGCACCATATCACCAATGTTGATAGTGTAA
GTGCCTTTACGCGGTGGGACGTTCACCCACGTCTGAGACTCTCGGTGGAGCACTTGCAATGACGCGACTTGGTCGTCTTGCAGCAGAATTGTGAGCCCGC
CAGAGTCCGTGTGGTGGTAGACGCCCATAGTCTTGTCCGGCTCGGGGGCCACAGGGTAGTAGTTCAGCCTCATCATACTCGTGTGAGTTTCGCCGAAGAA
CTGGTCGAAGAACGCAGGCTCTTCGCCTAGTGCCACTGCAAACACCTTCAGCAACCGACGAGCAATGAACTCCATCTTGCTGTAGTACGTCCTCATCTCG
GTTCGGAAGCCAGGCAGAATCGACTCGTCGAGCCACTGGTTCTGGTCGCCGCCTAAGCGTTCGTTCGTGTCGTTAGGTAGGCCATCTTCGTGAGGACCAG
CGACGTCGAAGCACTGCTTCCAGTCCGTCTTGTTCTTGGTGAGCTCGCCCTCGACGAAGCCGCGATTGTTGGTAGCGGTGCGGCGGATGGTGCGTTTGAC
CTCTGCTGGCAGGTGAAAGAAGGACCTCACGAACGCTTGGAACTCGTCAATCTCTTGCTGAGGCAGGCCGTGGTTGGCGATGTAGAAGAAGCCCCACTCA
CT