Description :
From Genome Similarity Track
Location :
contig_42:526256- 532058
Transcript NameFunction/comments
g9575.t1OWZ08386.1 hypothetical protein PHMEG_00019085 [Phytophthora megakarya
g9576.t1hypothetical protein
g9577.t1RAW43160.1 hypothetical protein PC110_g642 [Phytophthora cactorum
g9578.t1POM66275.1 2OG-Fe(II) oxygenase superfamily protein [Phytophthora palmivora var. palmivora

Sequence
5802 bases(100 bases per row)
CCTTCGCGGCCGATGGCTTCTTATCTTCGGCCGGCTCGCCCCCGTACAGCCGCGGCAATCGCAATGACGAGATGGACGTTATGGCCCAATTGGCCTCGCA
GTACTACGCGTCCAGCCGCAATCGCTCGTTCTCGGCGCCCATCCAGCCGTCGGCTCTGGGCTCGGCCTGGAATTCCTTCGCAGATGACACGTCCGTGTCA
GCCGCGGCCGCTGTGGCCGCCACGCAGCGCCACCATCAGATGCAGATGCAGATGCAGAATCAGAACTTGCGGCCGCATCAGCCACCGCTTCCGCAGGGTC
CGCCGCCTCCGGTGCTCAACATTATGGTGCCGCCACCTCCGCCTAGTGACGAGGTCGCTGTCGGAGCTATTGGCCAGGCCGTGCAGTCGTTGAGCCTGTC
GAGCGAGACGGAGACCAGCGACGCAGGACTTCACGTGGACACTACAGGGGACGCCATGGGCGCTCCGTTGCCGGCCACATTCCTCCGCACGATCTGCGAC
CAATTGGAGTACTACTTCTGCGACGAGAACTTGCTGGGAGACCTCTTTCTGTTGAAGAACATGAACATGGACGGATACGTCAAGTTGGACCTGCTGGCGT
CGTTCGGCCGCGTGAAAAAGCTGTCGACCGATATGGACCAGATCAAGAAAGCGCTGGAGCTTTCGACCAAGCTGCTGCTAAATGAGGACGAGTCCATGGT
CTGTCGCAAGGAGCCGCTGGCGCCCAACCAGACCTACCACGGCAAATTGGCCCGCACGGCCATTGCGTACAACTTGCCGGAAGACGCGTCGGTCGCGTCG
CTGCGCGAGACGTTCCAGGGCTGCGGCGAGATCTCGTACTTACGCCTGTTGAAGAAGAACACGACCACGGGTCGCAATGCCGTGCTGAAGCCCCCCATCG
CGGCGGGCGAGACGTACGCTATCATCGAGTTCGTGGACGACGAGATGACCAAGCACGCCGTGTTGACACTGTCGGACCAGTATAATTGGCGCACAGGGAT
GCAGGTGGTGCTCTTTGATGGCACGAACTGCGACAAGCTCAAGCAGAAGATGTTCCCTGTGGAGCTCGGCGGTGATCGCCGTCGTGCGAAGTCGGCGTCC
GCTCTCACGCGCCCCGTGCACGTGGAATCGGTCGGCGAAGGGCTGGACGACCTCCGTGAAGGTAAGGTGAACACGGGTACGGTGTACTCGATCCGAGGCG
CGGGTGGACTCATTACGCCGACGCGACAGGATTCAGCCTGTATCTCGTTCCGCCTTATCCCGGATGAAGATGGCAACATAGACATCAGGCAGGGCGACTA
CGTGTCGTTCACAGTGGGGAAGAACAAGAAGAGCGGCCGCAAGTACGCCAGCAAGGTCAAGCTGGAATTCCGCCCGCCGTCGAATCTGACAGGCGATGCC
AACAACAACGCCGGTGGCCTGAGCGGCCTGGCAGCGCTGAGTGGAGGCTCATCAAGTGGAAATGGGCAGAAGGACTACTTCGCTCCGTCGCCGAGTCGAT
GGGAGTCGCGTAGTCGCGCAGCAACGGTGGGCGCTCCACCCCAGCCGGGCGCCTTCCGTACTCGTTCGTCGTCGTCGGGCACGCGGCCGAAGTTGAACTT
GTCGTCGCCACGGATGGCGCAGTCACCTGTACACAACAACAACACCAGTAACCTCGGGGGTAACGCGTTGGCGCCTCCTCCTGGAATGGGACTCAACGGC
AGCAACCAGCTGTACCGCCAGGCCATTGGGCCGGACGGCACGCGGGGCTTTGGCTTCCGTCGTACCGGTGGTGAGGCACCGGAGATCGCACCGGAACTCA
AGTTCCGGTGATGGAGCGTCGGAGATCGCGCTCGTCGGGCGGTGCCTGGTAGACGGATGATGGAGGGCACTGACGAAGAGAGAGCACCACCCAAGGCTAC
TCTCATGTCGAAACACACGCTGGTACGAGCGTGATATGCTGGAAAATGACGAAGAATGACGAGAAACACTGAGAATTAGGCGCTAGCAAGACAGAAACGA
AGATGCGATTCGACGCGAGACAAAAAATCAAAAAGAGCACACGAAATGCACAGTTGATAGGAAGATAAGGAGGGCAGACACCAGGAAGCACGAACGAAAA
TGTATTGAGTGTGAGAACCCCCTTCAAAGTACCCAGTCTCCCGATCTACGTGGCCTACGCGTTGGCAACGTCTACGGGGCCGTGGATCTTGAAGTCGCCG
ATCTGGTTCTCCTTGCCATTGTCGGCGTAGTTGCCCTGGACGCGCTTCAAAAGAAACTCGCGCCAACTAAATGGACGGTAGTTGGCCAGCTCTCCTTCCT
TCACCACGATGGGCTCCACCTGGACATCATACGCCGGCAAATAGAAGAACGGAGCCGAGAATCGGCCAGCCTTGTTGCTTGCCAGCACGCGGTGCAGTGG
GGCCATGAACTTGTCGTTCGACCACACTTGCACCATGTCACCAATGTTGATGGTGTACGTGCCCTTACGCGGCGGCACATTGACCCACGTCTGCGACTTT
CGATGCAGCACCTGCAGAGACTGCCACCTCGTCATCCTGCAACAACACCGCAAGTGCACCGGGGTCCGTGTGGTGGTAGACGCCCATAGTCTTCTCCGGC
TCGGGGGCCACAGGGTAGTAGTTGAGACGCATCAAGCTCGTGCTGTCTTCGTGGAAGAACTGGTCGAAGAACGCAGGCTCTTCGCCCAACGCCACTGCAA
AGACCTTCAGCAGGCGACGAGAAACAAGCTCCATCTTGCTGAAATACGCCCTCATCTCGCTGCGAAATCCAGGTAGCGTCGTCTCCTCGAGCCACTGGTT
GTGGTCATCTCCCATCCGTTCATGATCGTTGGTCACCGGGCCATCTTCGTTGGGCACGGAGAAGTCGAAGCACTGCTTCCAGTCCGTTTTGTTCTTGGTG
AGTTCGTCTCGACGAAGCCACGGGCGTTGTTAGCAGTGCGTGGGATGGTGCGCTTGACCTCAGTCGGTAGGCGGAAGAAGGAGCGCATGGTCTCCTGGAA
CTTGTCGACCTCATTTTGCGGTAGTCCATGGTTGGCGATGTAGAAGAACCCCCACTCGCTGGCAGCAGTGCGCACTTCCTCGATAATCTGACGCAGCTCC
GGGCTTTTTACGCCACGCAGAGCAGCGTTTGCCTCAGCGTCGGTGGGGAACGCCACGAGGGCTCCGACGTCGACAACAGGTACTTGGTGCACGTTCATCT
TCGTCTCGAGCTTGCAATTTTCGGAATGCATGGCCTACACTCAGCTCAGCAGAGACAGCAGAGATCTTTCTTGGGCTCTGACGCTGCTTCAGTGGAAAGA
GCCATTGGCGCGTGAAGCAAAGTGCGTGTCACCAAGGACATCATGCCGTACGTTATCAGGTTCTATCCATGGAAGATAGTGGACCAGAACTCCATAGACA
ACGTTGGCAGCACCAACTTACGTTGTTTGGACTAGCCAACTACGCGTTCTCTATGGCAAACGCAACAAAGCAGCACTCTGGTGAGATAGGGATACGCCCC
TCGAAGCAGAAATCACTGTCTTTTTATTGTTTGCTTGAATTTGGTCTGCTTGTCAGACCAACCTACGCGTTCGCAACGTCAATGGGGCCATGGGTCTTGA
AGTCACCGATCTGGTTCTCCTTGCCCACATCGGCGTAGTTGCCTTGGTAGCGCGCCAACTGGAACTGGCGCCAGTTGAACGGACGGTAGTTGGCCACTTC
GCCTTCCTTCACCACGATGGGCTCCACCGTCACGTGGTTCGACGGGTTGTAGAAGAACGGGGCCGAGAAGCGGCCTGCCTTGTCACTAGCCACCACGCGG
TGCAGTGGCGCCACGAACTTGTCGTTCGACCACACTTGCACCATGTCACCAATGTTAATGGTGTACGTACCCTTCCGCGGCGGCACATTGACCCAGGTTT
GAGATTCCCGGTGAAGTACCTGCAGCGATGCGACGTCATCGTCCTGGAGCAGAACAGTAAGTGCACCGAAATCAGTGTGTGGTAGACGCCCATGGTCTTC
TCTGGTTCAGGAGCCACAGGGTAGTGATTCAACCGTAGCAAACTCGAGTGGTTTCCTTCGTAAAACTTGTCGAAGAATGCAGGCTCCTCGCCCAACGCCA
CGGCGAACACCTTCAGCAAGCGGCGAGCAATGAGCTCCACCTTCTTGTAGTACGCTTGCATCTCGTGGCGGAACCCAGGTAGCGCTGCCTCATCGAGCCA
CTGGTTTTGGTCTTCACCCAGCCGCTCGATCTTGTCCGTTGGGGGACCATCTTCATGGGCACCAGCAAAGTCAAAGCACTCCTTCCAGTCCGTCTTGTTC
TTGGTGAGCTCGTCCACGACATAGCCACGGTTGTTGTTGGAGTACGGAGGATGGAGCGCTTGGTCTCGACAGGCAGGCGGAAGAAAGAGCGCATGGACTC
TTGGAACTCGTCGATTTCTTGTTGCGGCAGACCGTGGTTGGCGATGTAGAAGAACCCCCACTCACTCGCAGCAGCGCGGATCTCTTCAACTAGGTGGCCA
AGCGCAGCACTCTTGGCTTCACGCAGTGCAGCGTCGACCTCGACGTCGGTGGGGAACGCCGTGAGCGCTCCAATGTTGACGACAGGTACTTGATGAACGT
CCATCTTGGCCTTGAGCTTGCAAATCTCGGAATGAACGTTGGTCTGCCTATTAACGTGCCACGGGAGGGTGGCGTTGAGGCTCTAGCGAGGGCCTTACGC
TTCTTGCATGACAAGCTCTGAAGTCTTGACGCTGCTTTCATAGGAAAAGTGATTGGCCGGTTCAAGATACCCTCGAAGTGCTGCCAGTAACACGCTTACG
TTATCGAATTGTATACGATTCGTCCAGCTGCCCTGCATGGCGCCTGCTGCTTTCTTTTTTAACTTTATCCACACGATGAACTTCTTCTCGATGATTCTTT
TTGTTAACTCCTTGGTCATGTTATCATGATGCTTTCTTGAAAACTTCACTCGTCGTCTACGAGTTAGCAACGTCGATAGTGCCGTGGATCTTGTAGTCGC
CGATCTGGTTCTCCTTGCCAAAGTCGGCGTAGTTGCCTTTATAGCGCTGTCCACGGAACTCGCGCCAACTTATCGGGCGATAGTTGGCCACTTCACCGGC
CTTCACCACAATAGGCTCCACCTGGACATTGTACGACGGGCCATAGAAGAATGGGACCGAGAACCGACCAGCCTTGTTGCTCGCCAGCACGCGGTGCAGT
GGAGCCATGAACTTGTCGTTCGACCACACCTGCACCATATCACCAATGTTGATAGTGTAAGTGCCTTTACGCGGTGGGACGTTCACCCACGTCTGAGACT
CTCGGTGGAGCACTTGCAATGACGCGACTTGGTCGTCTTGCAGCAGAATTGTGAGCCCGCCAGAGTCCGTGTGGTGGTAGACGCCCATAGTCTTGTCCGG
CTCGGGGGCCACAGGGTAGTAGTTCAGCCTCATCATACTCGTGTGAGTTTCGCCGAAGAACTGGTCGAAGAACGCAGGCTCTTCGCCTAGTGCCACTGCA
AACACCTTCAGCAACCGACGAGCAATGAACTCCATCTTGCTGTAGTACGTCCTCATCTCGGTTCGGAAGCCAGGCAGAATCGACTCGTCGAGCCACTGGT
TCTGGTCGCCGCCTAAGCGTTCGTTCGTGTCGTTAGGTAGGCCATCTTCGTGAGGACCAGCGACGTCGAAGCACTGCTTCCAGTCCGTCTTGTTCTTGGT
GAGCTCGCCCTCGACGAAGCCGCGATTGTTGGTAGCGGTGCGGCGGATGGTGCGTTTGACCTCCGCTGGCAGGTGAAAGAAGGACCTCACGAACGCTTGG
AA