Description :
From Genome Similarity Track
Location :
Scaffold_80:52620- 59164
Transcript NameFunction/comments
Phymu_g3703hypothetical protein

Sequence
6544 bases(100 bases per row)
GTTGCTtgacagcgactcggacagTAACTCGGAATCTGGCAGTGAGGACCCTACCCTTGTCAAGGGTGCCTCCAAGGGTAAGTCCGCGAAGACCCCCACC
GCAGCCTCGGGAAGCCATGATATCGACTGGCTGTTTGCCAGTGAATCGGACAGTGGCAGTGAGGACAGTGTCCCGGCCACCAAGGCGACCAAGTCCACCA
AGGCTACTAAGTCCTCTAAGACTGCAATTGAGGAAGACTCGGCCTCAACGTCGACGTCTGGATCGGAGGACTCGGCGCACCAGAGCGAGCAGGTGACGCA
GCAGTCGTTCAAGTAGGAAGCACATCAACTTGATGATCAACAAGTGTCCTATGGATACATCTCAAATACATTTTGTCTATGTTGCACCCAAAAAAAAACC
TGATTTCGAGTAAATAGTTCAAATATCTTAAAACTGTATAGCATTTCTATTTTGATTCAGCAATAAAACCCTTTTAGCAGTTTGTCTATTCCAACCCACC
TCTTAAAATCTATCGATTGTATACCCCCACTGGATGTTCTAGGTGTATAGTGGATCACTTTACATTTTGATCGGATACTCAAGAAGGGCGGACTTGTGCA
GGTCGACATGGGGCAGGCTGGCTccgtgcagcagaagagcgcGTTACGCGATGTTCTATCGCTTCGCCGCCCCAACGTCAGCAAcacggagctggaagaa
gttcttcgcACCTTCTGCGCCTTGTTCCCGCTAGAAGTGAGTCAAGAGCACAACTCAGCTTTAGCTGCCATTTGGTTTACCTTTTAGTTTACTTCTCACA
CGTTTGTGGTTTACCATTCCgcattgagcagctccaagtaccGGTGGACGTAGACGCAGCTCtcatcagcagcgtcgtaGGCGTCGACGTGAAGGAGCGT
CGCCTCTTTGACGTAGTACACGGCCTCCTAAAGGACCAAACGGAGCAGGCGCAGCGCAACAATGGACGCGACATGACGGAGCTGATCCTCACGAGCTTCC
GCCGCATCATTCGCTGGCGAGAGCTCTACAAACTGTGCGCCAAGTGCTCCATGAAGCCTTTCCTTGCGTGTTTGTACCGACCGTCGCCGAGGATCGtgct
gtcggtgctggagacCCTGCAGTTGATGATGTCGCCCTGTCCGGGCTTTGAGGTTGGCGACAAGGCAGCAGAGCGAAGCGAGGCGGCAAACAGAAGGAAC
TTTGGAGATGCTGGGGGCTTTGAAGTGTTACGTTCGCTCTTGACGCAGTACGGAgctgcactggagaagaaggagcagaaagaagatgcagcagctgtgC
TAGAAGgaatgttgaagctgttccacTTGACGTTGGTAAAGAGGCGAGTGGCGACGGATATGGTGACTTGTACAGAAGCTGTGGCGGCTCTGATGAACTC
TCGAGTGTCGTTATTGGACTTGTGTCATTGCAGAGATGGAGACGGGCAGGTCATGCGACTTGCGGTTGCATTGGTGAAGGAACTCTTTTGCATTGTGGAT
CTGAACCAGGTACACGACttgcaagaagctgcaagagAGTATGGCGCGTTGCTGTATGCGCTGGAAACTGCAGTGCAGGAAGATACAGAGAATTCGACAG
AGAAGGCAAAGGAGACTGGAAATGATTTCGAAATGCGTGAAATGTGTGTGGATCTTGTGGAGGTGTTTTGTGCCGGCAACACTCGCTCGAAGAAAACGAT
GTACCGCATTTTTCCAGTGGATCTGTTTATACCGGTTAAAACTCATATGGAGCTTATCCCACGACACTCTGGAGCATCACCTTCTTTGATGGCGCATACC
AAGACTCCTGTTGCCGCTCGCAGCGCCAGAACGCTACCACACTTTTCGTTTGAGATTGAGCAGCACCCCAGACGCACATCGATAGCATCGAATGCTTCGA
TAACTAATGGAAGTGCGGATATTAAACGAAATCGAGTGGTAGCTCTGGCATATAACGCAATGAATTTTGGTGGAGGTGCCTTTGAACGATGGCTTGGTGA
TGCTCGTGAGAAGGGAGAACATTGGCGTGAAATTATTGAGGCTGTCCGTCAGACACATGAAAGGCCAGAGCTCGTATGGCGTTCTTCGATGCGAGCGGAA
CTTCGACAGGCTTTGCAAGGTGAAATTAAAGCTCTTGAACGGCGGCGACAGCTAATGGCAGAAGATGATACTGAACAATCTGGAGAACTAATACCACGAT
GGGATCACGAAATGTTTTGTGTGGAATATCCTTCGATTCATGAAGAACTCGTGGTAAATAACTACTTTGTGGAGTATCTTATTCCTCGAGTGGCTGATTT
GGCAACGACGTATGAGATCACCGAGCCTGTTGTATTAGCCTGGCATCTCTCGGATCAGCTTGCGGTCGAACACGACGAAAATTGGGCGCTACTATGTGTG
CGATGCCTGCGTTTAGTCATCAGACGCTATGCTATGCTGTTTCATGGCCAACTTCCGACCCAATACGTGTTACGATTGCTCCGCGACCACATGAATCATT
CGCCGGCTTTTGTGCGTGAATGTTTCCTTCTGCTAAACACTGCTATCATTACAACCCGCAGCACTCCGTCCGAGTGCTTCAACCAACTCTGCGTAAATGT
AACGCGTGCAGTTATCGATGTTGTCACGGATCCAGTTCTGTTAGCAACGTTCTCAGGCCCCCTCGAAGTGGAGGATGAGTCGATCCAAGCCACTTCTCCA
CATCTAGCAGAACCGGAGGATGAGGCTGTTTCCGTGGTCAATGACCGTGATGCATTGATACGAGCTGGTGTTTCTCTCCTGCTAACGGTTATCCGTCGTG
GGAAGTTTGTGTTGCGACTGGTTAGACCGAAGCGCATGTTCTTGTGTCGCCTACTTGCAGTGGAAACACTGGACCACCTGACTATCACCCGATTACTGTT
TGTGCTAAAGCAATTGGCATTGCTGGACAACACTGTCGACTACATCAGCTCAACTGGCTCCAGTGGTATTTCGTCTGCCCCCTCTCCTTCACGCCCGTCA
TCTTCAGTGTCATCACACTCGAGTACAACAACtgacagcaactggagaTCTCTCACGTTGGTATATGTTCTACTAGCAAGCTGCGACCCGAAAGGCATGG
GTATGTGTGTGGCCGCCGCTGAATTTTTGAAAGAATGCTGCGTATTACCCTCAAGCTCACGTGGTACAACCGGACCCAAGAacacttcttcagcaccgCC
TTCGAATGAACTTAACGATTTACTGAACGAGGCACTTGGCTTTGGTGGGTGTGGTATTGGCCGACTCCTAATTTCCGCAAGTGCTGAAACTTTTGCCGAC
ACATTTAATGCATCTCAGAAACGAGCGGCAGATGTGAACTGGGGCCGAAAACAGCGCGTCCGCTTGTATCGATATCTGAAGCATAAATATTTGGGTTCAG
GTGGATCGTTAGAGGCAAAAACGTCGTGGAGCAAGTTCTTGGAAGACGACGCGGAGCACCGCTACGAAGACGATGATCTATTCATTGGGAATATCTTCCT
GCGGTCTTACATTGAAGGTGATGGGGACTTTTTGAATGAGTGGACGCCCGAGTTGTATAACGAGTTGATTAATTCCCTATTCGAGGAATTAATGATCCTC
GGTCGCCGAAAATCTGGATACATTGGGGCTGAAAGTAGTGGTCCATTGCCCTCACCCCCGCATCAGCCATCTCTGATTCAATCTTCAAGCAGTGGTAGCT
CTTGCGCAGCGGAACCGTGGGAAGTGCAAGTGTTGATCCTGAAGGCGTTGGCGCGGCTTGTTCCATCGCATTGTGATCAAGTCAAAATTAAGAATGAGTA
CTACGATTCTTTGCTCGCCCCGCTTCGTCGCTCCATGCTTAGCGACGTTGACCAAGTGCGCGGGATTTTATCCTTGGAGCTTTTCGTGGCGCTAATATCT
GTCCCTGAGACGCGCAGTGTCAACACGGCTGCCTGTCGACTGTTTCTGGAAGAAAAAGGTCTGAGAGTGCTAGCTGACTCGCTTGAGCGAATGCGCAGTC
CGTCATTTCAGCAACTATTGCAGACAGTCGAAGTCTTTGGTCCTCGTCGCCGTAGTAACCCAAGCAACCAAAACATGGCGCGCGTACTCCTGTACCGCTC
TACCGACGTCTTGTCTATCCTGGCTAGGCAAAAAGAAGCTGGGATTCGCACTATTACGAAGAATCCAGAGGTGGTAACAGCTTTGATTGAACTGTCGTCT
CGTCAGATTATCACGCAGTACGCAGACATCGACGCAGCGAGCGTGTGCTTAAGTTGCCTTGGTGGCTTGTGCCACTACGATGAACTTCGAACGCTAGTGG
TCAATGCCGGCGGGCTTCTATCACTTCTGGATACTGTTGTATTTTGTCCAGCGGAGGAGCTTGATCAAATATCTGTTAAGGAATCCCAAGTTACTGATGA
ACGAAGCGAATCGGAAGCATCAGATGCCGGtgacggacaagaagaagtggtAGAAGATGATTCGTCTAGAGGTACTGACAACGTCGGCGGCGGCAAAGGC
GCTTATGGCAAGGAAGGAAAGGAATTTCAACGGATCCCTTCCAGATTCTTTGGTGCAATTCGAAGCGCTGCACTGGTACTGCGTGCGTGTCTGGGACCGC
GAAATGCCCCCACGCCATCACTGCCTACTCAAGTGCTGTATCAGCTACTCACTCCAAGCTTCGTTCGGGTAGGCTAGCCAGTGTGCCGACCCTGGAGATG
GAAACTAACTGTGTTTGTCGTCGTTTTTTTAACTGTATAGGTGTTGCGGACGTCCCCTGATCAGTTCATTCTCGAACTGCAGACTACAGAAGATATTAAC
ACAGCAACACTCATCTGGACGGTTAGTATGAGGCAGCGGCTGCAAAAGTGTATTGCAACGGAGCTTACGAAAGTCAAGGCGGCAGCTGCTGCAAAGACGT
GGCCTCGTTGGAATCCAGAGCACTTTGTGGCTGCTGACTCATTCCGATACCAGTATCCGGAACTAACCGAAGTCCTTGTTTTGCACGACGTCTATCTGGC
AAACTTCGTGGCTACACCAGTAGACGACTTGGATTTGGGAGATATCGACATGGCATCCTTCTCTGAAGCGTTGTTGATCTCCATTCAGAGCCATGAGAAC
GTGCTTCGTATCCTACAAGACCGAGGTTCCAGCGACCCCACAAAAGAAAATGCTGTTCGACTGATGCGCCAGGCTTTGGACAAACTGGTGAGTAAACACC
CGCAGCACAACCTCGAAGTGGATGTGATCCCGCTTTCAGACGGATCACCAGCCACCTCGCCGGCAGTTTTTTCTCCTGAAACGCTGGCAGCGGCAGGGCA
CAACTTTTCGCCAACAGATGACCGGGACTGGGATATTGCGCGCATCGAGCGCTGTAGCTCGTCGGGAATAGAGGACCTCACAGTATAATTCACAGTATAA
TTGCAGTTTTTTTTGCAAGTAGAGTTTGTTTGATTTTTTTCATTAGGGACTTGATAAAATAGGacggtacagtgtaccattGGATGAGTGACCAACATTC
TCTTGAGTACGTCATCATCCTTCTCATTGGTCGAGACGCGATCACTGCAACGGCTGAACTTCACAATGGCAACGGCCGAGCTTCAGTTTCAAACTTGCTT
CCAACCTGGTAAGTTGCAGGTGTGGAGATGACTCGAAGCTCCTCAAAGGAGGCGACGCCTCTACTAGGCAACGTGGCGGAGCGtctggacgccaaggaga
agaaaaacaccCATTCGCGTTGGAGGGACGACGAtgcggacgacgacagcagcagcggagacCCGCTGTCTCCCAAACGGAGGCGCAAGTCGGCGCAACG
TCAGATGCTGTGCATGCAATTCAGTCTGCTGCTACTGTTGGCCTGGGATCTGGCCAGTCTCGTCGTagtctgcagcttcagtctCGGGGGAGCGGCCTTC
ACGCAGTTGAActggctgctggacgtgcaaCAGCCCCAGTGGCGCTTCTGGGGGTTACCAGTGTGGGCTACAGCGATCAAGTGCGTGCTCTTCCTACTGG
CTACGCGGTGGCCAGACGCACGCGCTGTCACATGGTTCGTGAATCTTTTCTGTCTTGCCTTCCTGAGTGTGCTGGCGGTGGATGCCTTCAAGTTGGACGC
AATCTCGCGTTTGGATGAGGAGCGACAGGCTCTGGTGGACGCCAATGTGGCCAACTCGCTGCCGTTGATCTTTACGGtgcttgaagttgtcaaTTTGAGC
TTCTTATTGGGCTCGATCAGGACGCCATCGCCTGCAGAGAGTGAAGCACTGCCACAAGTTGCGGCGGACAAGCCCACAGAACCCGTAAAGCCCCGTGGGA
TTTCATTTGTGAAGCTTGTTTACATCTTAAAGCCGTACTTTTGGCCACACGGGTTTGCGAATAAGCTGCGTGCGGGAAGTACCTACTTGGTACTGATTTT
GAGCAAGCTGGCGAACCTGATGGCTCCTCTGTTTATGGCATCGGCGACGAATGCTCTTGTCGCGAAGAATGTTACTGGGGCAATTTGGGATGTTGCCATT
TTCAGTTTCCTGACGCTGGTGTCGAAGTTGTTCAAGGAGTTGCA