Description :
From Genome Similarity Track
Location :
Scaffold_65:52613- 53647
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014530Similar to TOS1: Protein TOS1 (Saccharomyces cerevisiae)

Sequence
1034 bases(100 bases per row)
CGCCAGCGCCAGCTGGCAACTCGGATGCGTACGCGAACAAAGCCACGGCGGCGCCAGCGCCAGCTGGCAACTCTGACGCGTACGCGAACGAAGCCTCGTC
GGCGCCAACGGTGGGTGCGGCGAAGACCGCCGGCTCTACCAAGCTCGGCAACGTGCGCGCCACGTACTCGTACAAGGGCAAGCAGGCCGGTAACATCCCT
GGCACGTACAACCGCGTGACGAAACTGAGCGGCTGTGTGAAGGAGCAGGTGTCGGTGAACTCGCCAGTCGGTCCGCTGAGCGAGGAAGTTGGCATCGTGT
TCCGCGGCCCGATGGAGATCTACAACATCGCCGTGTTCTCCGGCGAGAGCCACGGCAACGGCACGTTCTCGCGCGTGTCGTCGTACGCGCGCGACTCAGG
CGCGACCGAGAACCTCATGTTCATGAACAACAAAAATGTTGACTATTCGGGCGGGGGCAAGCACGGTCCACAGGGCTTCTCGACCGAGGACGGTCTGCAG
AAGGCGGACGCGCCAAAGGTGCTCAAGGGCGTGCTCGCCGAGGCGACCAACCCGTCGCAGAAGGGCGCAGGTCCGGGCATCGAAACGGGTGCTGAAGTCA
ACATCATGACCGGCAAGTCGTGCAAGGACGGTGGCTGCCTCGGCTACCACGGCGACAACGACTACCACGGCTGGGGTGGCGACAAGAAGCTGTTCGTGAC
CAAGGTGAAGATGCCGCAGGGCAAGTCGCCGAACCAGCCAGCGCTCTGGATGCTCAACGCGCAGGTGCTGCACTCGAACCAGTACGGCTGCAACTGCCGC
GGTGTTGGCAGCGTCGGCGGCTGCGGTGAGCTTGACATTGCCGAGGTCATCGAGACCAATGACAAGCGCGACAAGGTGACGACGCACTACTACTTCTACG
ACGGCTCGGTGCTCTCTCCCGGCGGCGACAACTTCGCGGCGCGACCAGTGGACGCGCCCACTGTGTACCTCACGCTCATCGATGCCGCGAACGGCGGGCT
CATCAAGATCATCCAGGTGGACGACTTCGACTTC