Description :
From Genome Similarity Track
Location :
Scaffold_3698:526- 2276
Sequence
1750 bases(100 bases per row)
TCCTCCCATCGATATGACCAACTCACATCAACGAATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCG
CAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGTCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACTAGAAATTCACGGTAAATC
CGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCAGTGATCTTCTCGACTTCGAACTCGTCGTCTTCGAGATCCATATTCCAACTATCTTCCGGTAGGA
GGACTTCGTCTAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACGTGTAC
TACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCGTGCCATAGATGGGCC
AATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTAGATGTGGACGGGCATCTTCGTTGTGTCGATCCG
CTCGATCCTGTATCGCACTCCGCAGTCGTTCTTTCACCTGGGATCTAGCTTGCTGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTT
TCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCTTACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCT
TGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCTCTCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTCT
GCACCATGCGCTCGGCGGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGA
CATAGAGCCTGGCTCCCGATCATGTATAATCATCTCGCTAGCTCCCAATCTTCGATAAACGCACTCCTCGTACGATTCAGCAGTGGTCTGCGCAGTTCTA
GACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAATAATTCTGTGTTTCCTTTGAGCGACTTGGGCAACGAGGGGATATGAT
CCATGGCTATGATTTGGAAAGCGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGAGCCTGCCCTTGCCTGTCTCACAATCCACACATTC
GCCGACATACCATTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGGTGTCCGCCTTCCAAG
CTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAACCCATCCCGATCCTTGTTGACTCTCTTCGTAGGGGGGG
GGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCAT
CAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGGGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGG
GGGTTGGATCCAATTCTTCCTCTGGACCTAGTGACGGCCATCACCTGGAC