Description :
From Genome Similarity Track
Location :
Scaffold_2396:526- 1945
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2396-snap-gene-0.1Serine protease family S10

Sequence
1419 bases(100 bases per row)
TCGAGTGTCTTCTCGACCGCGTGTTCGCACGCAAGGCTCGCCAGTATGCTCTCACTAACGCTCGACTTCACCGAAATCCATATAAATACCGCAAGCTTGG
CGGTTGTTACGAAGAGCAAGAGAGTGTATCGGGCGGAAGAGCTCAAGATGGACTTGATTAGCATCGCGAGTGCTACAGATCTCGATATCGTTCAAGCTGC
ATACGATGTAGAGAAGCCACCAGCGCTAAGCAGTCATTCGCGAAAGTAACAATTGACAATTGACAACGAAGGCGCAGCAGCCTTCGTGACTGCGTAAAAT
CTCGCGGGAAGGAATCACATTTGCTTAAAGTTATTCGCAGTGCATTTCTCGACATTCTGGTATGGATGCCCACTGGAAAAAGACATTCCACGTACATTTG
CGGCTGGTACTGAAATAAAGACGAAAAGATTTAACGCTGGCGCTGGCTTCCGTTTGCGATATGGCGGCCTCACACAAAACAAACTACAATACCTGGTTCT
TGAAGAACTTGTCGATCATGTCGAGCGACACAGCAGGCTGGTGCGCTGGCACCATGTGACCGGCGTTGAAGACGCGGAGTACTGCAAAGTTCCCAAATGA
GCGAACCAGACCAGCGTCAATAGGCGAAGCATTGGAGTTGATCGGATCGTGGGCGATGAACGAGCGCTGGTCGACACTGTTGAAGCTCGTCTTGCCGCTC
CACTCAAGCGCGGAACTCCAGGCTTCGTTGCCCTGCCAGTTGCATTGCGCGTCCGCGTCGCCAGTGTAGACGAGGACACGAATACCACCGTCGAGCAGGT
CAGCGACGTACTGCTCATAGTTCTTCATGTAATCACCTGACGTCCCTTCAAGATTTTCACCTGCTTCGTCGCTGCCTTCGACCCACGTCTTCACAGGACC
ATCGGCAACGTTGAGGTACTTGCGCACGGATTCCAGGTTGAAGAAGTCCCGCACGTAGTCCATCCCATTGCAGATGCCGACAGTGGGGGACTCGCAAAAC
TCTCGGATGTCGTATGGATTGCGCTTGGACTGCGCGAACACCTTCGTCTGCGTTTTGTAGCAAAATGCCAGTGTATCTGCACAGATCGTTCCGTTGGTTG
GGTCTTGCTGACACTCACGAGTCATCTGGATACATACTTTAGTGTCCTTTGCCATCTGCTCTCGCTGGGCGTCCGTGATTAGCGTGATGTTGTACGAGTT
GTCGGCCATGTCGATAAAGTGTGCATTCTGTAGAATCGCACACCAAAAGCAACATCAGCAAAATGCGATCAGCTCAATGCACACAGCCCACATTACAACA
AGGCAAGCCTGAATCATTTTACAATCGGCTGCATACCTGAATGATCGGGTTGACCCAGCCGTTGCCGATCGCGATGCCCTGCAGGTCGATGCGCTTGGAG
CCAGGTTGCTTGGCACCCA