Description :
From Genome Similarity Track
Location :
Scaffold_1073:526- 1922
Sequence
1396 bases(100 bases per row)
CCGGATACTGCTTGGCCGGCGATCGCTGCGTCTCTCAATCGACCTCGATCCCGCTATAGGAAGCGGCAATCAACTCAGGAAAGGAAGGAACATACCCGGA
AAGGCAACTACAGGCCGTGGATCGACTCCAGGACGACCGATCGGAGCGAACAACCCTCGATCGGAGCGTATACTCGGACGCAGAGCGAAGATTCCCGCGC
TGCTCCACAACCTATCCCCGCGTCACGCCAAGACATTCGATCTTCACCAAGTGCTGCATCTTCGGAGCCCCCAGAGAGCAAATCCAGCCCGCCGACGTGT
ACACAAGGTGAGAACAAGTTCAGCCGATCATGGATCGTTGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCTGGTGGGAAGCTCGATTAGGCCTTAAC
CAGATTTTGGCCGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTCTTGGGGACTGCGGATTTCACCGTGAGTCCGTAGAAGATGCGCAAGTGAA
GAAAGAACCAGGGGAAGAGGCGTCGTCGGATATCGGATCGACGAAGACGCTGCTGAACAAAACGAGATCCGCGGATCGACAGAGTGCTCGGAGGACTTCT
GTCGACGGAATCGAGGGCGATCTGGAAACAGATCTAGAAGACAAACCTCAACATCCTCCCCAGGTCCCTTCGGGGACCCCGGTGGATCTTGGTGCGAACC
GAGCTTCACTAACAAAACAAACTAAGGCGGGATCGGACCGATACGCGTTCGCTGACTCGCCGATCAGGCTCGATCTGGACTACCTGGACGCGATCGCGGA
CAAGGACCAGATCGTGAGGAAGAAGCTGAGAGCGCCAGGCCTGGACGACGAAGATCCCAGACCGTCGGCGCTCGACTGGTCCGAGGCTGACCTGGATCGT
CAGTATCACTTGAAGGAACTGCGACACTTCTTGCGTCAAGATCCCGTCATGGTGATCTTGCGGCCAGAGCAGATCGACGACCCGAAGGACCCGATCTCGA
CCCCCCCCCGAGTGACGGACAACAAGCTGATGGCGGTGAAGAACCTGCTCGGGCTGTTGAAGGAAGCCGGCTTCGTGGCTGGCGCCTTTGAAGCGAATGA
TCTTTTCGATCAGGATCTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGACGTGATCGGACAGTCCGGACCTGAA
GGTGCCAGATCTAGTGTCGCCAGCTCCCGCGTCGTCGCCGCGGATGGAGTCCACTGGGTACCGATCGTCGTCTCCTTATGTCTCCGCAGCGGAACACGTA
TCAGATACGTCGTCTGAACCTCAACGGATGTCCATCCGCGGCGACGACGCGGGAGCTGCGATGCTGGACGCACGATCACGGAGTCAACGTCAGGAA