Description :
From Genome Similarity Track
Location :
Scaffold_1399:5258- 6548
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1399-fgenesh-gene-0.2Arabinan endo-1,5-alpha-L-arabinosidase A

Sequence
1290 bases(100 bases per row)
TGTTTACACCACTGGCCAGCCAGTCGAGAAGTTGATCTGGTTCCACCCGAGCTTCTTCTGGCCGTCCGCATAGCCCACACGCGTGTCCACTGAAGATGCA
ATAACAAACACAACACGCACAACCGTAAGCAAGATGTCTAAAAGCTCACAAGAGAAGCCAAATGCCGACCGGCACTTACCGTAATGGTAGTACAGAACGG
GTCCGTACTTGGGGTCCTGCATGACACCCTGGCCACCTGGGCCGTAGACGTAGCCGTGGGACGCAAGCACCGTGGTGCCGCCCGACTTAGTGCACGAGAC
GCCGTTCTTGTCGACGAACCCGCCCGTCGCCGATTTCGAGCGGCACGCCATGATCTTGTACTCGGCACCCGCCGCCGGTCGTTTTTTGTCGTAGTTACAG
CAGCTGCCCTTGGAGAAGAAGAGGTAGTAGTACGATCCATACTTGAAAATGGTGGCACCTTCCATCGCCGTGTTGACCGAATCGTACGCGATCTGGTACG
CGCTGCCCGATGGCCGGTTTGGTGAGCTCAGTTTCACCTGGTAGATATCTTTCCAGAAACTACCAAACGTAAGGTAGTGGGCGCCGTTGACGTTGATGTA
GTTGGCGTCGATCGCATTGTATGGCTTCGTCTTGTCACTCGCGACCAGCACCGTGGAATGGTCGGTCCAGGAGCCGACCTCCATGGTCTTGGACGTCGNN
NNNNNNNNGCTGTCGCTCGAGATGAGGGCAGTTGAGTGGTCGGTCCAGGAGCCAACCTCCATGGTCTTGGACGTCGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAACTTACTGATCGCATAGTACATGTAGTACGTGCCATC
GATGTTCGTAACGTCTGGAGCCTATCAAGAGCAAGTATACGAAATATATAGAGAGAAGAGTACGAGCGTCAATCAGTTGCTTTTTAGGCTCCTAGTGGAT
GCACACAGCTTTCAAAGTTTCCTTACCCACATGTCGTTTTTGCCCGTCCGGTTGATCTTGGAGCCGCCTGTCATCGCGTTTCCCTTGTACGTCCATGGAC
CAGTCAGAGCTGGCGCCGAGTGGACAGCGATACCTCCGCCCGTTGAGAAGCGAAAGTACGTGCCATCCGTGCGACGCACGATCGACGAGTCGTGAGCATT
CACGCACACGCCCGTGCAGAGCTTCGGGTTGGCGTAGGCATCAACGAGGCTTGCGAGCAGCGGCAATCCAAGGAGGAACGAGACGAGCTT