Description :
From Genome Similarity Track
Location :
Scaffold_28:52578- 54676
Transcript NameFunction/comments
Phyta_totarag1500calcium-activated potassium channel subunit alpha-1, putative
Phyta_totarag1501GTPase, putative
Phyta_totarag1502hypothetical protein PHYSODRAFT_486267

Sequence
2098 bases(100 bases per row)
GCAGGTTGTGCTTGATCTCTTACGGTTTGATACACTAACGCTGTGAGTTGATCCGCAGGGAGCGCCGTCTGTTCCAGGTCGAGGCACCCGACGAACTGGT
GGCACTCAAATACGGCGAATGTTTCCGCAAGTTCCTAGACATGGTTCGTGCATTGATTTGTTGTTGTGATTGTTGATGTCTACACGAGTGTTGGTCGTAC
TAACTAGCAGCTTTCTTTTTTTCAGGCGAGTTGTACTGTCATTGGGTTGTGGCGCCCAGAGCGAGGCGTAGTGCTTCCCCACCCCTGTGTCTTCATCAAC
CCACCGATGGAGCTCCAAATCGAGCCTGGcgatctcttcttcgtggtggGCAAACCCTTCACGTTCGCTTCCAGCCCCGACATCTTCACTCCTTAACTTA
AAGTTGAAGTAAAGTTGCATTTTATTTGCACCAATCAGAAGACGTTTGTACTCCAAAACTTTCATCCAATCACTGAACGGCATCTTCTGTGGTGCAAACG
TCAGTAAGTTTATCGGAGACCTCGTCCTGCGTTGCGTCCTGCGTGAATATGAGTGCGTTCCGGTCCAAGTTCCTGTATCCTGCTAAGGTGAACTGGTTCC
CAGGCCACATGGCTCTAGCCAGACGCCAAATGGTGGCTCAAATGGATGCCGTGGACGTGCTGATCGAGGTGCGCGATGCTCGCATACCCTGGAGCTCGGC
CAACCCCGTCCTGGAGGAAGCTTTCGGCAGGTCCAAGCCTCGCCTCGTGGTTTTCAACAAGAGTGACCTGGCCAACTCCAACATGCAGCAAAGAGTGGAG
GAACAGTGCAAAAATGAGCTCGGAAGGGCCACCGATTGCCTCTTCACGTCCGTGACCAAAGGCAAACGGCTGCAGGCCATCCTGCAATGGTGCAACAAGC
ACAGTCAGGCTCAGTTCAAAAGCACGGCAGGATCCATGGTCATGGTGGTCGGTATCCCCAATGTGGGCAAGTCCTCTCTCATTAACGAGTTCCGACGCTT
GTCGAACTCTCAAAAACTGGCAAAAGGCCGGAAGAGAGCCACCGTCGGACCTACACCCGGTGTCACCGTTCGCAACGACATCATCAAGGTATGTAGAAGG
CTGAAGAGGAAGTCCTTATTAAAGGTTATCAACTGATGTACTGAGTTATTACTTTTTTTGTAGGTGAACGACAAGCCAGCGGTGTATGTGGTGGACACAC
CCGGTGTCATGCTGCCGAACATCCCATCGGCTGAGACGGGAATGAGACTGGCGCTTACAGGAGCTATCAAGGATGAAGTCGTGGGCACCGAGTTGATTGC
AGACTAcatgctgttcctgctgaatCAGATGAAGTCGACGCGGTACGTGGACGCGTTGAAGCTTCCAGCCCCGACGGACAGCATCCGTGAGCTGTTCAAG
CTCGTGTACAAGCGTTGCGGTGCCTTGGGCAAGGAACCTGATGAGCAAGATCGGTTGGCTGCGCAGTTTTTGCTGCAGGAATTCCGTCAAGGAGCGTTTG
GCAACTTCACGCTTGACGCGATTGAAACGCCCCCTAACGTCATCAaacctgcagcttcttcgacgtaATATGGCAGCGGATAATGAAAAGCTGCAGTAGC
AGCCTCGTTCCTGCTCCATAGATACTTTGTTGGCTTCAACCCTCAATTGTGTGAGAGAGGATCAGAAGACCAGATCCCAGGTGtgaggacgagaacgagt
gAAGCAAGTCTTCCCTATTCTTAGCGGTTTGTCGTGATGGTGGCGTGGTCATCCAGTttgcaagttgctgccagcTCGCGCAAGTCGTTTCGCTTGGCTT
GTCGATACCCGGGAGAACGACTCGACACCGTACACAGATAGCTCGAGGCTGGCAGCACCAAAAAAAGGTTGCCAAAAAGCAGGCAGTGCAACCGCCGGCC
GCAACGCGGGATGATTCAATTCCCCCCTTTCCGCACGGGCCACACTAGAATGACAGACACCCACACACGGGTGTCCATGGCGAAAGTGATCCCCAAGGAC
GACTCCGGCAAGGTGCTCGACATGGTGGCCAGCAGTTTACACAAGAACGAAAACCAGCAAACGCTTACGCTTCCATCCCCGAAAACGCCCAACTATGG