Description :
From Genome Similarity Track
Location :
Scaffold_1163:5257- 7164
Transcript NameFunction/comments
Phypl_g12620Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1907 bases(100 bases per row)
TCATTTCCGAATTCGCCTTCGCCTGCCAACGATGTCCAAGGTGCAGTCGCCAGCGCTCACGCCGCAGCTGACGCCGTCCGTCACGGGCTACGTCAACACC
AAGCTCTGGGACGAACGGCCCGTCCGGTATGCCGCTAACGTCCTCAAGCACGTGtgcatcttcctcctcatccTCACGGCATGCGAGGAAGTCACGAGCT
TCGCCATCGGCCAGTCGCTCAAGAACTTTTTCCAGAAGTTGGGCTGGTCCAACAAGGGCTCCACCTCCATGAAGCTCACGTACGACTCCTTCAGCCAGTT
CATGTGCATCGTGGCCGGGTACATCGCCGACGAGCGCCTCGGGaagttcaagacgctgctgtcagCCGCCACGCTCGACTCCTTcggcctcctcttcctc
gtggtCGCCGCCCTGCCGGTCATCGTGAACAACCACCTGGGCGTGAGCAAGGCCATCTTCAAcgtcggcctcttcctcggcgTGGCCGTCTCGCAGATCT
GCCTGCGCTCGCTCGTGATCTCATACGGAGGCGACCAGTTCTCGCCCAACGCGCCGCCCTCGGAGAaggcgctcttcttcagcatccaGTACTGGGTCGC
CAACATCGGGGCGTTCATCGGCTACGGCGTATTCCCGTCCGTGTCCATCCACGGCTTCGGTGCCATCCCCGCCGACTACGGCTACGTCAGCGTGTACCTA
GTGGGCTTTGCCATGCTGTTGATCTTCGTGGCTCTGCTCTGGGTCACGCGCAGACGCTACGTGAACGTGCCCCCCACCAAGCAAtccgtggcgctcgtga
tCCAAATCGTGCTCGAccacgccaagaagaacgcgagcGCGCAGATGGTTGTGCTCGGCACGGTCCTGTACATCGCTGCGTTCCTGCTCAACATCCTCGC
GTCGGTCTTGTCGGACCAGGGCGAGGTCGGCCACAACATCTCGTACGCTTGCGGCGTCATGATCGTCGTCGCGACGGGGCTCTGGGTCTACTTCGGCCAA
AGCTCCGAGTTCATGGAGTCGGCCAAGGACACGGTGGGCGGCCGGTTCGACCCCGAGCTCGTGAACGGCGTCAAGCAGGTCGTGCGCATCCTGCCGTTCA
ACGCCTTCAACGTCTTCTGGTGGGTGTGCCAGAACCAGCGCGGCAACAACCAATCGATCGTCCAGCAGAGCGACACTCGGCTCGGAAGCGGCCCCTTCTC
GTCACAGATGCCGGGACCCACGGTGCAAATGTTCAACCCGATCGGCGTCTTGATCTTCGTCCCGctcatggagaaggtggtcTATCCGCTGTACGAGAAG
CACGCCGGCAAGCCCGCGAGTCGGTACGGGAAGGTGCTAACCGGCTACTgcacggccgtcgtggccatgGTCTGGACGGGCTGCTACGAGATCATCCGTC
GCAGCACGTCCCCGCTCACGTACGTGGACTCGAGCGGCGTGACGCAGTTCATGatcaacgacgacggcaaccAGGTGATGAACGACATCCCGTGGTGGAC
GGCCATCCCGCAGTATCTGCTCGTGGCACTTGCCGGGGTGATGATCGCCATCCCGTCGTACGACATCAACTACTCCGAAGTGCCGCAGAGCATGCGCAGT
ACGTCCATCGCgctcggcttcttcgtcaacTCGATGGGCAGCACGCTGCTCTCCatcatcgtgctgctcttcggcaagTACATCCCCGCCGACCTGAACG
ACGGCCACATCGAGTACATGTTCTTCACGCTGGCCGCCGTCATGATCGTCAACACGTTCTTCTACGTCCTCGTGATGAACAAGATGCAGCTGGGAATGAT
TCCGCGCGTGAAAAAAGCAGGCGAGaaggcggacgacgaggaagcccagccagcagcggcgtAAGTTGTCGTAGAAAGAGGATATTTTGGACGTCCGGTG
TGTTAAT