Description :
From Genome Similarity Track
Location :
contig_121:5256- 6695
Transcript NameFunction/comments
g13425.t1hypothetical protein

Sequence
1439 bases(100 bases per row)
AGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGA
AGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTTG
TGTTTTTCCTGCCGGTGTTGTCGGCGTTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGTTGGAC
AAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGTTGTTCGTTGTCGATTGAAGTGTCT
ACGCCCGTCGTAGACATCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTTACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAA
TTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTC
CTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAAC
CAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAG
AATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGG
CTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACC
AAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCAT
ACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTC
CCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTA
AAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCC
AACAACTGCTTCGCATCCGCATCATGTGCGTATGCGGCC