Description :
From Genome Similarity Track
Location :
Scaffold_161:5256- 6461
Transcript NameFunction/comments
Phyke_g5619pectate lyase

Sequence
1205 bases(100 bases per row)
CTCACTCCAGCGTGCCCACCCCAAAGTTGTTGGACGCCACCGTCAATAACTGAGGTGGCTGTGTAGCGTAGCCATTAATGACAGGGTACAACTTCACCGC
CTCAAGAGCTTTCGTACCGTTCATCGAGGCGAAACGCCCGCTGCTCTCCAGTACATTGGCGACGCATGAACGGCCGAGATATTGCGAACAGAGATTTTCT
CCGCTCTCCGTGTAGATGGAACCATAGTCACTGTTACCGATATCCGgatcgtcgccatcgtagAGCGGCTTGGTGGTGTGCTTGAAGTAGTTGCCTTCTG
CAAGCACATAGGAGCCCGTCGCAATCTCCATAGAATGATAGGAGTTGTCTTCGTAGTAGTTGTTTGCTATGTGAACAATAACGCTGTCAGGACTGCCGGC
CCTCGGGAGTCGTCCAGACAAGGAGTGGATGTAGTTATTGACCATACTGACACCGTCGTGTTTTCCGTAAAAGATGAAGCTCCAGTAGTGATGACCGTCG
CACGTCTTAGAGTAGTCGGTGTTACCATCAAGGTCTGAGTTGCTGATGGTCATGGAAGCCACGCCGGCAGCGTTCGTTGTGAGGAATTGCCGTCCAATAT
GAGAGATTTTGATGTGGTCAAGCCAAATGTGCTGCATGGGGACACTACCGCCATTTGTGCCCTGCATATAAAAGGCGTCACCACCCCACACAAGGTGTCG
ATTCAACTCCGTGATATGAATGTTTTGCACGATAATGTTGTCACCGTTGAGCCACAAACCCTTGCTCATAAGCACTCCTCTCGTTCCAACGCCGCGGATC
GTCTTGTTGCCTGTCACCGTGAGGAATGTCAACGCTGCTTTGTCGTACGTGACCGTCACGCTTGTGCCGTTCGTGCAGCCACCGGTGTTGTTGAGAGCAC
CGCCCTGAAGAATCACGTCCTGGCTTTTGAAGCCGTTGTTCAGCGCCATGCATTTGCGAGTGTAATCCGGGCGGCAACCTGGTTCTGTCACAGTGCCTTC
CGTCCCACGGAAGTCAAAGGTCTTGTTCAGCACAATCACCTGAGGCTCTTTGCTTTTCAGGTACGAAACGAGCTCAGCATTCGTCGTGGGGTACACAGCG
GATACGTTGCCTCCACCAGTGGCACCAGCCGCCATGCCACCAGGTGAACCAACCGTGAAGGCTTGGGTGGACTGGGAAAAGAGAGCCACGACCGCGGCGG
CAATG