Description :
From Genome Similarity Track
Location :
Scaffold_1063:5254- 9440
Sequence
4186 bases(100 bases per row)
TATCATGATTGCGAGAGGGAATGCGCTACTACCCCCCGCTTATGATGTGGTGTGCGACATTGACGTCCAGGGACACGCACCTATCAAACAGCGGGCACGG
AGACTACCTCTGCGTCATATCGGCAAGCTTTACGAATTGTTGGAGGGTCTGCTGAGAGCCGGTCTGATTTCGTTCTCTGACAGTCCATGGGCATCGCCAA
TCGTGATTGTGCTGAAAAAGAACGGACAAGATATCCGACTTTGCATTGATTACAATATGGTGAAAGCGATCACAGCAATCATGGAATATGCCATGCCGCT
AGGCTAGTTGACGATTTGTTGACGGATCTTGAGGGCTACCTGTGGTTTTGTTCTTTGGACGCTGCGAGCTGTTTTTGGGCCGTTATGATGACCCTCCGAG
CACGGAAGATATCTGCATTCGTGTGTGCATTGGGGCATTTCGAGTGGTTGCGCATGCAGTTTGGGCTGAAGAATGCACCTATGATATACCAGCGTATGAT
TGACAACGCGCTGTGGGGCTTTATTGAGCCGAAAGGAGGCTGGGTGCATTTTGCAGAACTAATGCGAACGGCTGAAGACAAGGTTAGACGACTTCGCCAA
TGCAGCAACGAGGAATCAATTCAAACTGAGTTCGGGGTCGACCACGAAGCATCGGTGGACACTGATCCTGTATTACAACTGGTCAATAGCTCTGCAGCGA
ACATGTTCATGGCTGGAGAGGCCGATGAATCGTCGCTGGTGCCTGATTTCGGTAGACGGTCGTTCGTGGATGATATTTGCTTCGGTGGCGAGACTTTCAG
CACCTGTTTAGCCACTCTGGACCGATTGTTGGCACGGTTTGCTCAATGTCGGATCAGCGTTAGTTTCACCAAAAGCGTATTTGTTCAACCGAAGGTTGGG
TTCCTGTCTCATGAAATTTCCCAGACGGCATAAGAGCGGATACGAAGAAGCTTCACGCTATCACCGAGTTTTCATTCCCATCGTCAAAACGTGGGATGCA
ATCGTTTCTTGGAGCACTGAACTACTATTGCCGATTCATTCAAGACTTCGCGGTCTATGGAGCAGCTTTGTACCAGCTCAAGGAAGCAGACTTTGAAACA
GGAGGCAACCTCACAGTAGCCCGCTGCGCTACAGGAAAAGGTGGCAGAAGCTCCGATACTAAAGCACTTCGATCGTTCCAGAAATGTTCACGTTATGCTG
TTTGCGAACGAATGGGCATTGAGTACCACATTGATGCAAGAACATGATGGCAAGATGTGCCCAGTTCGATTCCTCGATAGAGTGCTCGAGGACGCTGAAA
TGAATTATCATCCTGCGGAAAAGGAAGTTTTAGCTCTGTTGCTATTGCTGAAGACCTGCTACACATAGCTGGCTGGATCAACACTACATGTCTATACTAG
GTTCTCGACGCTGGAGTGGATACACAGGTCAAAATCGCTGTTTGGACGGTCAGTCCAATTTGCGGTATTACTATCGCCGTGGCATCTTATCGTCAAGGGA
GTGAAGGAGACAGACGTGGCATTTGCACAGCTACTCCAGGCTAGCATAGCGAATTTTATTGACCTGGAGAAATCACTTGCGCCGTTAACACCACCAACAA
AAGGCTCTCCGACAATTCGAATGGACCCCTTACTGATGGATCAGCGAAAACAGAGAAGTATGGCGGTTATGGAAGTTGCTCGTGGGTATTGTGGAAGTTA
CCGGAGTGGAAAATAGTGATCACTGCGAACGCTTACCTTTCGTCTACCACTGAAAACCTCGCCGAGTATACAGGGATGAATAATGGTGTCAAAGCGGCTA
TTGAGTATGGCGCCGCTGATTTAGTCCTTGTGGGTGACTCTAGGCTCGCGATCCAACAATCTCTAGGGGTGATCGCATGTCGGAAGGAGTCTCTCGTGAC
ATTGCTGAATCTTTATAAAACACTTACTTCGAAGCTTCAGTCAGTGAAATACCTGCACGTGGTGAGAGAATATaatgcagctgcagactcACTAGCCACT
GAGGCTTTGGAGTCCAAAATGAGCCGGGTAGTCTTCGCCGAATCTCGGAAGGATGACTTTGAACCGCATCCAGGAAGTAATCTACGAACCGATGGAAGAC
CAGGCGGAGGTGGAATCACGTGATCATATGCATTCCATTGCAACTATGGCCGGTAACGAGTTCTCACAGCGGAAAACCTTTGAGAATTTCGTGCGAAGAG
ACACTTCAGTCGACCACGGAGAAATGACTGTATTGACTCGAAGGCAGGCAAAAGCCAGGAAGCGCGTCAGGTTTGCCGATGAACACTCGCTGCACCACCC
AGGAGCAAAAAAAACCAGAGGAGAATGGGCGGAAACACCCAGCGAGGGTTCACCAGACAGTAATACTTCACATCATCTCAACAATACGGTGTCACCAGCA
GTTTCGGACGCAACAGATGTCGACCCGATGAAGATTCAACGTGAGCGAAGAAAACGGATTGCCCGGgcacaagatgaagagctgaAGTAGGCAAACCTTA
AAACGGTGTTGACAGGTAACGCAGAGAATCTGCGCTACCGAGAAGCCCGAGATGCATGGAAGTACGCGGATCGATTCGTTTTATCTGAGGATGGTGTGCT
CCACTACNCGACTAGTGGTACCGACAACGATGATTCAAGAGGTCTTACAGAACTGTCATGATTCGCTGGAAGGTGGTCATCAAGGCGTGGTACGGATATT
TCAGCGTGTTAGGTCCGACTACTATTGGGCTGGGTTGTACGCCGATGTGGAGAAACACGTGAAGTCCTGCCCAGACTGCAGTTCGAGCAAAAGCAAGCCG
CAGCTACGGAGTTACTCACCCGGCAATGTGTTAGCCGAGCGTCCGTTCCAGATTGTTTCGATGGATTTTGTAATACCACTGCCAAAGACTCGCAGGGGCA
ACACtgcgttgttgttgtttcAGTGCTCGTTCACGGGCTTCACCATTGCCAAAGCAATGTCAGACACCTCGGCCCTCAGCGTAGCTCGAGTGTTTGAAGA
GTGCGTCTACCGAAGGTTTGGAGCGCCGTCGTTGATCAGACACGATCGATACCCACGCTTCATGAGTGAAGTTTTTCAAGCCTTCACAGAAATGATGCAG
TGGAGATCTCGGGCAACATTGAGCTATCGCCCACAAGCTAATGGACAGCAAGAACGGTCGGTGAAAACGGTGATGACTTCAGTACGTGTATACGCGGAGG
ACCCTCTACACCAAGACTGGGATGAGATTGCTGAAAGGTTGGTGTTCGCCATCAATACCTCTCAAGACACGACGCGAAAAGAGACACCGTTTTACCTCGT
TCATGGGTGGGATGCACGATCTACACTCAAGGCTATGTCGTCTTCCCTCCGACAGGGACTCGGAAGACAGTCTGATGCGTTGACGTGGAGGCGCGAAGTC
AATCGGCAACAAGAAATTTCACTGACTATGGCTAAGGAGTATCAAGCGTCGGAAAAAGCTCGACGTGTCAAAGCGCACAATGATGCTCTAGGCCGACTAG
AGGAAGCTTCGGTGCCACGCCCAAGTTCGAACGAAACGTCGGTATGCGGCCCAGAGGCTTCAGCAGACCCATACGATGATGCCGACGGGCTAGCGAAGTC
TCTTTTCAAAGTTGGGAGCAGGGTCTGGCTATAcatggagcgcgtcaagCCAGGGCTAACGAAGAGGTTGGCTCATCGCTGGCATGGTCCTTTTAGGATT
AAGCGCAAGATCGAAGATTTCGCATACGAGCTGGATCTTCCCGATCGCAGTGGATATCGCTTCTATCCCGTGGTTCACGTGTCTAGACTCAAGGCAGTCA
ATGAATTTCCCAGCCGTCCAAGAACTCAGTTGGTGCAGGATACGACCGAGGATTCGCGCCTGGACTTCGATGAAGAATTGCTTCCAGAAGATAGCTGGGA
ACCAGATCATCTGGTAGGCGAATATGAGGTATAAGCGATCCTCGACGACTGCACTCCATTGTTAACACGCACTAAGCGTTCGGTACGAGAATTCAAGGTC
AAATGGGTCGGCTATGACGAGCCAACATGGGAACCGGCGGCCAACTTGTCTTGTGGCGGCCTCCTATACGACTATCTGCGAGCAAGGAAGAGTGACCGGC
GATAGCAGATGGTTCAGGTTGCCGACGAAAACTAAAGTGGCATTATCGTCACTTTTGAACTGTCCGCGGGGCGATGCAGCCCGCGG