Description :
From Genome Similarity Track
Location :
Scaffold_196:52529- 53545
Transcript NameFunction/comments
Phypl_g5096hypothetical protein PHYSODRAFT_262200

Sequence
1016 bases(100 bases per row)
AAATCGGACACTGCTGCCGAATTGATCGGCGTAGGAGTCTCCTTCGGCGCGAAGTTAGCGACGCTTGATCCGGACGTGGCAGGACTCATAGACGCGCGAC
CACCGCGAACCGTGTGGTGCCCTGCTGACGCAGCGGGCGTACTCCGTGAGTGCGGAGTACCTGTCGGGGTATCGGTGTCCAGCCGGTTATCGGTAGGCTT
GGGCGTACCCGTTGTACCGGTATCCAACCGATTATCGGTCGGCTTGGACGTACCCAGTGTACTCAGCTGGGTACTGGCTGGAATCAGCGGGATATCACTC
GACGTTAGCGCCGACTGTGtcggtgttgctgcagctcctcccCCACGAAGCGTGGAGACCGGTGATGGGCCTGGAGCGCGCACTGCAAGAAGCGCCGGAA
CGCGCGGGTGGCGCGCGTTATTCACGAAAAACGGGGTCAAACCCGTGGACGCATAAACGGCTTTGTTCAAGGCGAACTCGGCCAGGGGTAGGAAGGGGCt
ccaggacgagaaggacgtcGCGTAGCTGTTTAGGACGTCTTCGAGAACCCGGTTCACGCGCTCCGTTTGCCAATCCGTCTCCGGATGGGCCGCCGTCGAC
ATGAGCAGGCGAGTGCCCAGCAGTTCGAACAATCGCGTCCAGAACGCGGAGGTGTAGCGGGGGTCGCGGTCCGAGACTATGGACTCCGGAAGACCATGGC
GGCGGAACACCAGGTCGAGGAACAGCGCGGCGGAATCTTCGACGGTCACTTGGGCGGCGACTGGAGCAAGATGGACCATCTTGCTGAAGTgatcgacgaa
gacgaggacaCCCGTGCGTCCCTGATTGTCGCTGCGGAAGCCCAGAGACGAAGTCCATGCTGACGAatcgccacgcgctcgtgaCGATGCGCAGCGGACG
CAGCGAAGCTTgcttcgacgccgccggcttGACGCGCTGGCAGATCTCGCAAGAGCGAACCCACTTGCGTACCCATTTGTACATACGGGgccagaagaag
tcgcgAGAAAGAGCTG