Description :
From Genome Similarity Track
Location :
Scaffold_437:52528- 54504
Sequence
1976 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTGACCAATGACGCAATCTTTTCGAGGTGCATGTTGGCAGCAAACAGCTTCGCCT
TCACGTCAATGCAGGTGCCAATTGGATGCATCCCAACCTTCGTACCCAATGACAATGCCACCTGAGCACACTCATGACAATGTTCGTGGTAGTGCTTCAC
AAACGTCTTGCGTTGGTCCACCGAGTACTCTGAATAGAGAGGGACTTTCGGCGCAGCAAATCCACTTAGTAATGGGACAATTGTTGATGCACTGGATATA
TAACCCTCTGGGATAAATCCACCCCCGGAGTTGGTTGAACACTAGTCCCGATGGTGTAACTCCAGGATCCTTGGTATGCCAGTCATAATTAGAATTGTCT
TGGCTGGGGCTTTTCATAGTTTTAAAAGACTGAGTTAAAGTCATGCGCCCCCGTTCCTTCGCAGCTTCACGCTCGCGATCACGTCGTAATAATTCGGCAA
TTTGAAAGTACAATTGCCGCGAGAAGTTTAAGGCTTTTCGGGCCTCATCTTTGGCGATCTGTTCCTGGGTGTGGTAGTGCCACAGGTGTGCTTCTGCCTG
CGCCGCCCGGCTCGCATGCTCTTCCCCAGCTTGTCTGGCCGCCTTGAGATCTTCCTCAACGCAAGTCCAGCATTCTGCATGGACTCATCTTTACAGACAC
CCGAGCTAACTCGACAGCCTGGGCGGCAATCTGTTCGTCTGTTGAGCTCGTTCCAACGCAGCCAGTGCAGGGTCATCTGCACTTTGCTGATAGTGATGAT
GCACTTCATGGGACTGGACCATCACCGGGAAAGGGCCAAGTGACGGTCGATTTGAATGCTATGGGGCTGGAAGTGGCACCCGATTTAACAGTCTCAACGC
AGGCTCCTCGGCTATAACTCTCCTGTCTTCAATGCCACTCATAGTGGACGCTGCGTCGTCTTCATAGACAAGTTCTTCAATCTCCTGATATTTTGCATGA
AGATTGATTCCGGGATTGGCATCGCCTTCCCGGTAGTACGCTCCAACGGGTATCTATGGTTAGATATCTAATCGCTGGAGCCTTCCATCGACCAGGAGGC
CTTCACCCGCGCTAAACGACTAATGAATTTATTTATTGATGTGTTCTTGCACGCACAACGTCCGGTAACCACTGCTGAAGTCCGCGTCCTGGTGCGAGGG
ATAGCCTTGCTTCAAAGACGCCACTGAAATGATAAACTGATATATTAGAGAGATTAGATTGGCCTCTTCGAAGGAGCTGCCTGAGGGGTCGCGATATAGG
GACGTGAGACAATAGAGTCCTTGGAACAAGCTGCCTGAAACCCCGATGCCGTCTCATACCGACCACGCACATTCAACGTCGCGATATCAATAGTTCGATC
CGTATGATCACTACAACACTTGTGACTTGGACTTGTTATGGAAGCAAATCGTGCCGTTTGCCTTGAAAAGGGTGTTCTTGTGTGATTCGACACTTGAAAC
ACATAGTGGAGATGGATGCAGCGGTGTCGAATAGGGCGATGACGGTGTCACTGATGCCGTCATGGCGAGTGATCGC