Description :
From Genome Similarity Track
Location :
contig_42:525151- 531121
Transcript NameFunction/comments
g7779.t1conserved hypothetical protein
g7780.t1hypothetical protein
g7781.t1hypothetical protein PHYSODRAFT_469735

Sequence
5970 bases(100 bases per row)
CTTGTATGCTTTTATATCTGCAGCTCACTCTTGCAATTCCCTTCGTCGTCTCAAGTCCAAGTTACAATGTCATCCAACGCAGACTCGGGCCATTCGGGGA
ACCCGCCGCCGCCCCCACCGCTGCCGTCCTTCGCGGCCGATGGCTTCTTATCTTCGGCCGGCTCGCCCCCGTACAGCCGCGGCAATCGCAATGACGAGAT
GGACGTTATGGCCCAATTGGCCTCGCAGTACTACGCGTCCAGCCGCAATCGCTCGTTCTCGGCGCCCATCCAGCCGTCGGCTCTGGGCTCGGCCTGGAAT
TCCTTCGCAGATGACACGTCCGTGTCAGCCGCGGCCGCTGTGGCCGCCACGCAGCGCCACCATCAGATGCAGATGCAGATGCAGAATCAGAACTTGCGGC
CGCATCAGCCACCGCTTCCGCAGGGTCCGCCGCCTCCGGTGCTCAACATTATGGTGCCGCCACCTCCGCCTAGTGACGAGGTCGCTGTCGGAGCTATTGG
CCAGGCCGTGCAGTCGTTGAGCCTGTCGAGCGAGACGGAGACCAGCGACGCAGGACTTCACGTGGACACTACAGGGGACGCCATGGGCGCTCCGTTGCCG
GCCACATTCCTCCGCACGATCTGCGACCAATTGGAGTACTACTTCTGCGACGAGAACTTGCTGGGAGACCTCTTTCTGTTGAAGAACATGAACATGGACG
GATACGTCAAGTTGGACCTGCTGGCGTCGTTCGGCCGCGTGAAAAAGCTGTCGACCGATATGGACCAGATCAAGAAAGCGCTGGAGCTTTCGACCAAGCT
GCTGCTAAATGAGGACGAGTCCATGGTCTGTCGCAAGGAGCCGCTGGCGCCCAACCAGACCTACCACGGCAAATTGGCCCGCACGGCCATTGCGTACAAC
TTGCCGGAAGACGCGTCGGTCGCGTCGCTGCGCGAGACGTTCCAGGGCTGCGGCGAGATCTCGTACTTACGCCTGTTGAAGAAGAACACGACCACGGGTC
GCAATGCCGTGCTGAAGCCCCCATCGCGGCGGGCGAGACGTACGCTATCATCGAGTTCGTGGACGACGAGATGACCAAGCACGCCGTGTTGACACTGTCG
GACCAGTATAATTGGCGCACAGGGATGCAGGTGGTGCTCTTTGATGGCACGAACTGCGACAAGCTCAAGCAGAAGATGTTCCCTGTGGAGCTCGGCGGTG
ATCGCCGTCGTGCGAAGTCGGCGTCCGCTCTCACGCGCCCCGTGCACGTGGAATCGGTCGGCGAAGGGCTGGACGACCTCCGTGAAGGTAAGGTGAACAC
GGGTACGGTGTACTCGATCCGAGGCGCGGGTGGACTCATTACGCCGACGCGACAGGATTCAGCCTGTATCTCGTTCCGCCTTATCCCGGATGAAGATGGC
AACATAGACATCAGGCAGGGCGACTACGTGTCGTTCACAGTGGGGAAGAACAAGAAGAGCGGCCGCAAGTACGCCAGCAAGGTCAAGCTGGAATTCCGCC
CGCCGTCGAATCTGACAGGCGATGCCAACAACAACGCCGGTGGCCTGAGCGGCCTGGCAGCGCTGAGTGGAGGCTCATCAAGTGGAAATGGGCAGAAGGA
CTACTTCGCTCCGTCGCCGAGTCGATGGGAGTCGCGTAGTCGCGCAGCAACGGTGGGCGCTCCACCCCAGCCGGGCGCCTTCCGTACTCGTTCGTCGTCG
TCGGGCACGCGGCCGAAGTTGAACTTGTCGTCGCCACGGATGGCGCAGTCACCTGTACACAACAACAACACCAGTAACCTCGGGGGTAACGCGTTGGCGC
CTCCTCCTGGAATGGGACTCAACGGCAGCAACCAGCTGTACCGCCAGGCCATTGGGCCGGACGGCACGCGGGGCTTTGGCTTCCGTCGTACCGGTGGTGA
GGCACCGGAGATCGCACCGGAACTCAAGTTCCGGTGATGGAGCGTCGGAGATCGCGCTCGTCGGGCGGTGCCTGGTAGACGGATGATGGAGGGCACTGAC
GAAGAGAGAGCACCACCCAAGGCTACTCTCATGTCGAAACACACGCTGGTACGAGCGTGATATGCTGGAAAATGACGAAGAATGACGAGAAACACTGAGA
ATTAGGCGCTAGCAAGACAGAAACGAAGATGCGATTCGACGCGAGACAAAAAATCAAAAAGAGCACACGAAATGCACAGTTGATAGGAAGATAAGGAGGG
CAGACACCAGGAAGCACGAACGAAAATGTATTGAGTGTGAGAACCCCCTTCAAAGTACCCAGTCTCCCGATCTACGTGGCCTACGCGTTGGCAACGTCTA
CGGGGCCGTGGATCTTGAAGTCGCCGATCTGGTTCTCCTTGCCATCGTCGGCGTAGTTGCCCTGGACGCGCTTCAAAAGAAACTCGCGCCAACTAAATGG
ACGGTAGTTGGCCAGCTCTCCTTCCTTCACCACGATGGGCTCCACCTGGACATCATACGCCGGCAAATAGAAGAACGGAGCCGAGAATCGGCCAGCCTTG
TTGCTTGCCAGCACGCGGTGCCAGTGGGGCCATGAACTTGTCGTTCGACCACACTTGCACCATGTCACCAATGTTGATAGTGTAAGTGCCCTTACGCGGC
GGCACATTGACCCACGTCTGCGACTTTCGATGCAGCACCTGCAGAGACTGCCACCTCGTCATCCTGCAACACACCGCAAGTGCACCGGGGTCCGTGTGGT
GGTACGCCCATAGTCTTCTCCGGCTCGGGGCCACAGGGTAGTAGTTGAGACGCATCAAGCTCGTGCTGTCTTCGTGGAAGAACTGGTCGAAGAACGCAGG
CTCTTCGCCCAACGCCACTGCAAAGACCTTCAGCAGGCGACGAGAAACAAGCTCCATCTTGCTGAAATACGCCCTCATCTCGCTGCGAAATCCAGGTAGC
GTCGTCTCCTCGAGCCACTGGTTGTGGTCATCTCCCATCCGTTCATGATCGTTGGTCACCGGGCCATCTTCGTTGGGCACGGAGAAGTCGAAGCACTGCT
TCCAGTCCGTTTTGTTCTTGGTGAGTTCGTCTCGACGAAGCCACGGGCGTTGTTAGCAGTGCGTGGGATGGTGCGCTTGACCTCAGTCGGTAGGCGGAAG
AAGGAGCGCATGGTCTCCTGGAACTTGTCGACCTCATTTTGCGGTAGTCCATGGTTGGCGATGTAGAAGAACCCCCACTCGCTGGCAGCAGTGCGCACTT
CCTCGATAATCTGACGCAGCTCCGGGCTTTTTACGCCACGCAGAGCAGCGTTTGCCTCAGCGTCGGTGGGGAACGCCACGAGGGCTCCGACGTCGACAAC
AGGTACTTGGTGCACGTTCATCTTCGTCTCGAGCTTGCAATTTTCGGAATGCATGGCCTACACTCAGCTCAGCAGAGACAGCAGAGATCTTTCTTGGGCT
CTGACGCTGCTTCAGTGGAAAGAGCCATTGGCGCGTGAAGCAAAGTGCGTGTCACCAAGGACATCATGCCGTACGTTATCAGGTTCTATCCATGGAAGAT
AGTGGACCAGAACTCCATAGACAACGTTGGCAGCACCAACTTACGTTTTTGGACTAGCCAACTACGCGTTCTCTATGGCAAACGCAACAAAGCAGCACTC
TGGTGAGATAGGGATACGCCCCTCGAAGCAGAAATCACTGTCTTTTTATTGTTTGCTTGAATTTGGTCTGCTTGTCAGACCAACCTACGCGTTCGCAACG
TCAATGGGGCCATGGGTCTTGAAGTCACCGATCTGGTTCTCCTTGCCCACATCGGCGTAGTTGCCTTGGTAGCGCGCCAACTGGAACTGGCGCCAGTTGA
ACGGACGGTAGTTGGCCACTTCGCCTTCCTTCACCACGATGGGCTCCACCGTCACGTGGTTCGACGGGTTGTAGAAGAACGGGGCCGAGAAGCGGCCTGC
CTTGTCACTAGCCACCACGCGGTGCAGTGGCGCCACGAACTTGTCGTTCGACCACACTTGCACCATGTCACCAATGTTAATGGTGTACGTACCCTTCCGC
GGCGGCACATTGACCCAGGTTTGAGATTCCCGGTGAAGTACCTGCAGCGATGCGACGTCATCGTCCTGGAGCAGAACAGTAAGTGCACCGAAATCAGTGT
GTGGTAGACGCCCATGGTCTTCTCTGGTTCAGGAGCCACAGGGTAGTGATTCAACCGTAGCAAACTCGAGTGGTTTCCTTCGTAAAACTTGTCGAAGAAT
GCAGGCTCCTCGCCCAACGCCACGGCGAACACCTTCAGCAAGCGGCGAGCAATGAGCTCCACCTTCTTGTAGTACGCTTGCATCTCGTGGCGGAACCCAG
GTAGCGCTGCCTCATCGAGCCACTGGTTTTGGTCTTCACCCAGCCGCTCGATCTTGTCCGTTGGGGGACCATCTTCATGGGCACCAGCAAAGTCAAAGCA
CTCCTTCCAGTCCGTCTTGTTCTTGGTGAGCTCGTCCACGACATAGCCACGGTTGTTGTTGGAGTACGGAGGATGGAGCGCTTGGTCTCGACAGGCAGGC
GGAAGAAAGAGCGCATGGACTCTTGGAACTCGTCGATTTCTTGTTGCGGCAGACCGTGGTTGGCGATGTAGAAGAACCCCCACTCACTCGCAGCAGCGCG
GATCTCTTCAACTAGGTGGCCAAGCGCAGCACTCTTGGCTTCACGCAGTGCAGCGTCGACCTCGACGTCGGTGGGAACGCCGTGAGCGCTCCAATGTTGA
CGACAGGTACTTGACGAACGTCCATCTTGGCCTTGAGCTTGCAAATCTCGGAATGAACGTTGGTCTGCTATTAACGTGCCACGGGAGGGTGGCGTTGAGG
CTCTAGCGAGGGCCTTACGCTTCTTGCATGACAAGCTCTGAAGTCTTGACGCTGCTTTCATAGGAAAAGTGATTGGCCGGTTCAAGATACCCTCGAAGTG
CTGCCAGTAACACGCTTACGTTATCGAATTGTATACGATTCGTCCAGCTGCCCTGCATGGCGCCTGCTGCTTTCTTTTTTAACTTTATCCACACGATGAA
CTTCTTCTCGATGATTCTTTTTGTTAACTCCTTGGTCATGTTATCATGATGCTTTCTTGAAAACTTCACTCGTCGTCTACGAGTTAGCAACGTCGATAGT
GCCGTGGATCTTGTAGTCGCCGATCTGGTTCTCCTTGCCAAAGTCGGCGTAGTTGCCTTTATAGCGCTGTCCACGGAACTCGCGCCAACTTATCGGGCGA
TAGTTGGCCACTTCACCGGCCTTCACCACAATAGGCTCCACCTGGACATTGTACGACGGGCCATAGAAGAATGGGACCGAGAACCGACCAGCCTTGTTGC
TCGCCAGCACGCGGTGCAGTGGAGCCATGAACTTGTCGTTCGACCACACCTGCACCATATCACCAATGTTGATAGTGTAAGTGCCTTTACGCGGTGGGAC
GTTCACCCACGTCTGAGACTCTCGGTGGAGCACTTGCAATGACGCGACTTGGTCGTCTTGCAGCAGAATTGTGAGCCCGCCAGAGTCCGTGTGGTGGTAG
ACGCCCATAGTCTTGTCCGGCTCGGGGCCACAGGGTAGTAGTTCAGCCTCATCATACTCGTGTGAGTTTCGCCGAAGAACTGGTCGAAGAACGCAGGCTC
TTCGCCTAGTGCCACTGCAAACACCTTCAGCAACCGACGAGCAATGAACTCCATCTTGCTGTAGTACGTCCTCATCTCGGTTCGGAAGCCAGCAGAATCG
ACTCGTCGAGCCACTGGTTCTGGTCGCCGCCTAAGCGTTCGTTCGTGTCGTTAGGTAGGCCATCTTCGTGAGGACCAGCGACGTCGAAGCACTGCTTCCA
GTCCGTCTTGTTCTTGGTGAGCTCGCCCTCGACGAAGCCGCGATTGTTGGTAGCGGTGCGGCGGATGGTGCGTTTGACCTCCGCTGGCAGGTGAAAGAAG
GACCTCACGAACGCTTGGAACTCGTCAATCTCTTGCTGAGGCAGGCCGTGGTTGGCGATGTAGAAGAAGC