Description :
From Genome Similarity Track
Location :
scaffold_179:52509- 53717
Transcript NameFunction/comments
g5201.t1 hypothetical protein PHYSODRAFT_486841

Sequence
1208 bases(100 bases per row)
ATCAAGAACGCACTCAACCTTGACGTTGAGCACGCTCCATTCACCCACCCCGAACTGCTGGGTGAGTTCCCCACCAAGACCTACGGCCCCATCCCAGTGC
TGCCGTACGAAGACCGCGCGCTCAAGGCCGACCCGACGTTCAAGAACTTGCTGGCCGACGCGACGGTGACGCACCTGGAGCCGGAGATCGGCACGGAGAT
CTCAGGTCTCCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGTTGGCATTGCTGGTGGCTCAGCGCGGTGTGGTGTTCTTCCGTGACCAGAAGCTC
TCGATCGAGGAGCAGTTGGATCTGGGTCGCTACTACGGTCCGTTGCACGTGCACCAGACGGTTGCTCACGCGAAGGGTATTCCCCAGGTTCACGTGGTGG
AGAACTCTCTTGAGGGAAGCCAGAAGCGCATTGAGTCCCAGCTTTATGAGCATGTGAACGTTTGGCACAGCGATGTATCCTACGAACGTCAGGTAAGATA
CGGTGTTCGTTGGCCCAAAGTGATATCGTTTGGATTTCAGGCTAACCTTTTCCTTCTGTTCGTAGCCCCCATCGTACACGAGTTTCAAGGTCTTGACCAC
TCCGCCTACTGGTGGTGACACCCTGTGGGCTTCTGCGTACGAGGCGTATGACCGTCTGACTCCTCAATTCAAGAAGTTTGTTGAGGGTCTAACCGCTATT
CACAGCAGCAAGGTACGAATTGAAACTTTGATACGTAATTTGTTTTCTCCTATTAAGCACTCAACACTGCTCTTTTTATTGATCTAGCACCAAGCTGAGA
GCGCGATCGCGAAGGGCCAGACCCTTCGCCGCCCCATTGTGGAGTTTGAACACCCTGTTGTCCGTACTCACCCGGTGACTGGCCGTAAGGCGCTTTACGT
GAATGCTCAATTCACTACGCGGATCAACAACTTGTCGATCCCTGAATCCGGTACGTTATATTATGTACATATATCTAAGCTGGCACATCGCTAATGCCTG
TATTTATTGGCGCTCCAGATGCCATCTTACGCTTCCTGCTGCAGCATATCGCCCAGGGACAAGAGTTCCAGGTGCGCTACCACTGGACGAAGGACGCTGT
GGCGATTTGGGACAACCGTGCTACAGTCCACTACGCCACTTACGACTACCTGCCGGGCAACCGCCACGCTGTTCGTGTGACACCGCATGGCGAGATTCCG
TACTTCGA