Description :
From Genome Similarity Track
Location :
Scaffold_925:5250- 10211
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_925-snap-gene-0.6Cyst wall protein
Pytul_var.sporangiiferummaker-pug3_contig_925-snap-gene-0.7Conserved gene of unknown function

Sequence
4961 bases(100 bases per row)
ACGAGAAAACGCACACGCCGCAAAGCCAACGCGAGATCCGAGCGCTCTATCGCCTTTTTCGCTCGACGGGCGGGACAAAAGAGGGTCAGCCAGGTTACTG
GAAAAACCGAGCTGGATGGCCAGCACTTGAGCAAGCTGCAACAGAGTCTTCCGAGACTTTGCTGTTACGAGGCACGATAGAAATGCAGTTTCCACTATAT
GGGGTGGTCTGGGATCGAAACCACGTTGTCGCTATCGACCTATCTGAAAATGGACTTTCTGGCAAACTTCCAAGTGACATCGCGCACTTGCGGTTCCTCA
AAACGCTCAAGCTCCGCAACAACCCGAAATTGGTCGGAACCATTCCACCGGAAGTGTACTCGATGCCGCATCTTCAGTATTGCTATCTCGACGGTACGAA
ACTCGAGAAGACACTTCCATTCCAGACCGCTCATTCGTTTCAAATCACGCGGTTCCATGCTTCCGGTACAGCAGCCACGGTTTGCTTCCTCACAAACTTT
CGCAATAATCAAATCCGATGGACATCCGATATCACCGAATCGGAAATGTTCATGATGCACTCATCGTTGAAAACTCTTCACGGACATCCCAAAACACAGG
AAATTGCCATTGAGCGCAACGCCCACAACGCCACCGGACCTGAGCGAACCGAGGCAGTCATCAAGTTGCAGCGCATCTACCGCGCAAGAATCGAGCGCAC
CAAGTTCAGGAAATACCTCAAATCGCTTTTTGAGCGCAGCTTCGACCCGAGCAGCGGTTTCGAGTATTTCGTTGATACTCGCACTGGTGAGGCCTCTTGG
GAGAAACCAGTGTTCATCAAAAGTCCGCGAGATTCTAGCGACAACAATGACGAGCTTCTTGGCGACCAGAACATTGATGAAGCTTGGCAGCCTTACGATG
ACGGCTACGGGAATACGGTGAGTATTTCGCTCACTTTTCAAACCACACATATTCGATTAGATAGATACTTACTTCATGATGCCTTTTGCAAAATCACAGT
ATTATTGGAACAGCATCACTGGAGAGTCCACCTGGGAGCCACCTGTCTTTCTCAGCCGCATCTATCAGGAACTAAAAGCTCGATACGGATCGGACAAGAC
AGACGAAGAGCGTTTCGAACTTTTCTTCAAAGACATCGACAAGGACAGCACTGGTGAGATCAGCAAGGACGAGTTCGCTCTCCTTTGCGGTGAACTGGGA
ATAGCGATGTCAGACAAGCAGATTGACAATGTCTTCAAAGAGCTGGACACGAGCGGTGATGGGGAACTCAATCGCCAAGAGATCATAGCATGGCTGACAA
GATCATACAACTAATAACATATTTTTCTATTGTCGCACCGGGCTTATTCACTCGTCATCTCCCAATAGCTTGAGAAGCTTCTCCGAGTCGGCGATCGTAC
GCGTTAAACCAATTATCTGATTTCCAGTGATCAGGTAGGTATCTGTGCATGAGCAGGTGATCGTATTCGTACCTTCAGGTGCTGCTGCTGCATCAGACGG
TACAGGTCGCTTGCTCTCGTTCTCACCAGATTCAACTCTTTGAAATCTGGCATCAAACTCGACAATAACTGAATAACCAGTGGCGTACATCCGCTTTTCG
TCCACCGAAATGACTTGTAAGCACCTGTTCAGTAGCGACACGTACTGGTTCATGCCGTGCTCACCATGAAAAGTGCCCCAAAACGGCAGCTCTTCTGGTA
CTTCCGACTTGATAAAGAAATTAGGGGAAACCACCGGTCCGAGTAAATGAACGTTCGGAACGACATAGTAAGTCATCCCTTCTCTTTCCCGCTTTGTTGC
CACGCACTTCACCAGCATAATATTTTCCTCGTCATCCGCTTCAGTGATACTATTCCGCATAGCCTGCGAGTCGGTCATTGCTTGCTGCATCCCCTCATAC
CACATATTTCGAGTGGCATCTGTTCTGGTCACAAATGTGAGAGTCTTGTCCACTTCCCGACTTCGATCAAATGCTTCAACTTGAAAGCCGAATGCCCCGA
CACCTGGATTTTTCACACTTCTGCCGAATGCAATCCATTTCCGGGAGTTACAGACGACATATTTCTTCCGTCGTGACGTCCAATGTTGAGTTTTTGCCAT
CAAATAGTCCTTCAGTTTTGTTGTAGACTTTCCCTTCACTGGGGATGAGCTGGAGCCAGCAGAAGACCGAGTAGGCACCGGTACGTCCTCTAAAGTCAGC
AAGCAGCTACTCTTCTCGAATTTGAGATGAACTTTCACCCATTTTGATCGTTTCTGATACACGTATCCAGAAATACTGTCCTCGTCTTCGACCAAGTCGA
AAGACNNNNNNNNNNNNNNNNNNNNNTTCCAGTGTCTCCCTTCAGGACATCAATAATCGATTGCGGATACTGACTCTGTGTGCGACTCCGAAACATATCG
GTCGGGTTGATGATTTCGTTTCCTGTTGCAAGATTTTGCGGTGAACCAAAGCCTTCTTTCTCCATGGGTAAACGTCGAAATGGCTCGAGCTCTTGCGATA
GAAAGCCGGTCGCAGAGGAAGTGCGACGCGCAAGTGGAAACACGTCATCAACTCCATCACTTCCTCGCCTTCCATTCGCATTGTTCAGTCCACTGCCGTT
GAGCGAGCTAAGCCCCAGTACCGAATCATCTAGCGCATCAATTTGCTGATAATGAGACGCTACCAGCGACGAACTGAATTCAGCCCATCCGGCAACCTTG
TGGCAATATTGTCGAATCAGCTCTTGCTCCAGACGCGGCGAGCTGCATATTTTGTCGATCTTGACGCCGATAATCGCGAGATGAGCATCGTAGGGATGAG
TGGCAGAACTTTTGTGCAACTTGTGCATGATAAATGCCAAAAGTGAATCTGGGGGCCGAAATACACTCCGCAGGAGTGGATTGTTCACCCTTCCATTTGA
CGACACGCGATCAAATAAATTCAGGTACAACTTGACGATTCGACAGTGCAGGATGTTTGCTTTCGGGAACTTCTCAAAAATGTCAATCAATGACGTCGAC
AAGTCACACTTTGTTAGCTGTGCGTCCAAAGATTCTTTACCCATTCGAACAACTGCATCCAAGAAATCGATCACATGTATCACGAGCAAAATTGATGCGA
GCGGCCGATGGTTGATTACATTCTTTCCGGAGGACGGCGAGAAACACGTAGCAGGAGGTGGGATGCTGCTTTGGTGTAGATGCCTTTGCATCATTGCGGG
TGCAGCTGGAGGACTTGTAATAGGAAGAACTCGCGACAGTAACGCAGACTGGTTTTGCAGTTCATCGCTTTTGGAGTTATCGCCATTTGTATCCTCGTCT
TCGTCCATCGAGTCTTCCGAATCACTGTCGCTGAAGCAGTCTCGTGACGCAAACTCGGAGATCGTAGAAAAGTGCTGGTGATAGTTGATAGCAGCACAGA
GATTCTCAGCGAGTAGCTGCACTGGCGGCACGAACAACTTCAGTCGGTCTTTATCTGACAACGAGTTCTCGATGCCAAATCTCAGAACGTCGATGACCAA
GGTAGGAGGAATTCCAGCACCATCGGCGTGGTTTGCGTCCAAATACCGTATTTCTGCTATTGCAACTTCAGCTAATCGAATGAGAATGTTTGGTCTCTCA
AGGATAGCCGACATCACCCCATTCTTGATTTGTTCATGCAGAACGCGATCATTTGGTAAGATTTTCGGAGGAAAGATCTCGCGTTCGAAAGCTTCCACAC
TTTCGTACGACGCCAGCTGGAGCTTTGTCTGGATGTAATAGCTGAACGTGTTTGGAAACTCTTGTGACAGCACTTTCGCTAGAACATCAGCACATCCACT
GATTCGAGCGTGGGTCAACGGACTTCGTAGATTGAACTGGGAACGCGCCGACGACGGACTTGAAGGCATATAACCCGAATCAATTGATTTCTCGATGATT
CGCTCGACAAGGCTCTTGATGATCGGCTGGAACCCGTAACTTCGTCGTTGGGCGAGATGAAGGAGGCCATGCAGCAGCGTTGACACCTCCGGATTGTATG
CGTAGTAGGCGAATCGCGCAAAAAGAGTTTCTTTTCCTTGCACTTCGATTGTCGACAAAATCTCATGCACCGCTGGATATGTCACGAAATTCTTCGTGAT
TCGGCACATGTTTGCAAACAGGACACTGTCAATCTCGACCTCGGCATCGCTATTAGCAGCCCCCGCTTTACTCATACTAGCATTTACCGCAATCTCCTTC
TCCGAGCTCGACTTTGACCACATAAACTGATATAAACCGGAGAAAATGCGCTTCCATTCCGTAGCTGTAAGATCTTCCAGATGCAGGATGTATCCTCTGA
CAGCAGCACTCGGTTCACTCACATCGGAAAAGCTGCTGCTACTCCCTCTTCGGAAGCTTCGTGTTGAAAACGCAGATGGTCGAAAGCTTGTAGAGAAGCT
CAGCAAGAATGGCTTTGGCGGCAGTGAGGGCGATTTCTTGTTTGGACTTTGCGAATTAGGCGAGCCATTCTGTGGGGAATGCGACGCGTCTCCGACTGGC
TGCTCTTCCGAGCGCTGATTCTCCATCACAGTCGCTGGAGTAGCGGACGACAACGCTTTAGGCGAGCCGTGCCATGTCAGAGCCTTCAGGTAGAATCGCA
GGATAATCTCTGTCGCGATGTACGGGCGTCGGTACTTTTCCGGGTCCGAGATGTGATCGTTCGGCGCAGGCATTTTTTGCTCGAGCATAATCGGCAGCCT
ATTATGGCTCGCCTTGTGGTGACTACTTTTTTCGGGAAACGTCGTCGCGTACATAAACACCTGCGCAATGTTCTCGGTCTCGAGCAGCATCATCTGCATG
GGGGACATCGCGCGTTCGCGCTTCTGCACAAGCGACAGCACCGTCTCGGTCTCATAGCACGCGCAAAACACGTTCTGCAGCGTCTGCGCCTGGCGCAGCG
CCTCTGAGTTGTGCAGCGCATGCGACGTCTGGATCGGATCACGCACGCCCGACGTGTTGCG