Description :
From Genome Similarity Track
Location :
Scaffold_2606:525- 3058
Transcript NameFunction/comments
Phypl_g15249reverse transcriptase

Sequence
2533 bases(100 bases per row)
gacgacgcaGGACTCATCCACGAAGGATCGGACCTCTTCGCagaagaactggaagcggAGATGGCGGTGTTGCCAGAGATCTCGGTTACGGCAGAAGTGC
GAATCGGGGATCTGAAGGTGGGAAGGCCGACCGGGGATACACCCGAGGAAGCCacacagcaagaagagcgcctACGACAGGTTATCCGGAGGCGACGAAA
ATGGCTTATCGGGAAGGGCAACGCTTTGCCGCCCGCGGCCGTGGGAGTCGTCTGCGATATAGATGTGGGCGACGCGAAGCCCGTAGCGCAACGCGTCCGC
AAGATCCCGCCCCGATTCAAAGAAAAGGTGTCCAACTTGCTCAAGGGCTTGCTCAGTGCTGGCATGATCAGACTGTTCACGTCGCCGATTGTAGTGATCG
TATAGAAGAACGGGGTCGACATACGACTCTGCATCGATTACCGACTGGTGAACGGACTGACGCAGCTGATGGTTTACCCGATGCCGCTCGTGAACGACTT
GTTGGAGGATTTGGACAAGTACCTGTGGTACTGCTCTCTCGACATGGCCAGCGGATTCTGGGTCGTCCCCACGACGGCTCGAGCCCAGCTCATCTCCGCG
TTCATTACCCCGTTTGGCCTCTTTGAGTGGCTGCGCATGCTATTTGGTTTGTGCAATGCGCCACAGATCTATCAAAGGCTGATCGACAACGCGCTCTACG
GATTCATGAGTCTGTCGACCGACCGCGATACTCGGAACGTCTTCGACGAGGGAGAGCCGGAACCCCCAGGGAACCACTCCGTCCTAGGTCGGAGATCGTA
CATCGATGACATCCTAATCGACGGTATGTCGTAGGACGATTTGTGCACGAAGgtggagcggctgctggatgtCTGTGAACAATGGCATCTGCCCATAAGT
GTGGAGAAGAGTGAGTGGGGTATGTCTCGAGTCGACTACCTGGGCCGCAAGGNAGGTCTCTGAAGCCGGAATTGaagcgaagccgaagaaCCTGGAATCG
CTCGCGACATTGGAGTTCCCGCACACGCCCAAGGGTCTGCAGTCGTTCCTAGGTAGCCTGAACTACTACCGCCGGTTCATCGCAGACTTTGCGATCTACA
CGACGGCACTGTACCCCTCACAGAGGCCGACTTCGGAGCGTACGCCACCCGACCGGAAGTTCACAGCCAGGAGAAGTGGATACACGCGTTACGCGCAttc
gagacgctgaaggccaagatcgccAAGACACCGATGCTGAAGCACTACGATCCAGACCGGGAACCGGTGGTCATCGTGTACGCCAGTGAATGGGCGATAT
CCGCGGTACTCGCACAGGATCATGGCGGTGTGTGCATGCCAGTGAAGTTCACCAGCCGCACACTCAAGCCCAACGAGCTGAACTATGACGTCGCCGAAAA
GGAGATCCTGGCTCTGTTGCGCGTCTTGAACGATTGCTTCACGATGTTGGCCGGGAGGGCGATCCGTGTCCTGACGCAGCATACGACGTTGGCGTGGCTT
TTCCGATCTAAAGGACGGCAAGACCGACTGTCGCAGTGGGCCGCGATACTCTCACCGTGGAGACTCGAGATATTCTGGTCCATgaaaggagaagaagaga
tCCTGGGAACGCTTGTCGCGAGTATCACGCCTAGAGCGTTCGtcgacacggcgctggaagagatCGCTCCACGTAGACGTCCGTCGCGAATCACTGTCAT
CCCGATCCCGGCGGTTTCAtcggacgaagagctgcatgtTGTCAGCTTCGACAGAtcggccaaggccaagcgcgaagGCGGATCATTCAGCGCGATTGTC
TGGAAACTGCCGGGTTGGGAGATAATCCAAGCCGCATCGGGCTACGCGTCCGACCTCACGGTCAACGAGGCGAAATACCGAGGATTGCTTCTGGgatgct
cgctgctggaagggCTAGAGGTCGCACGACTGGTCGTCTGTGGAGACTCGAACCTCGTCATCCGGCAGATGCGTGAGGAGATGGACTGTAAGTCACCGGG
CCTGAAATTGTTGTGACAGCGAGGTCGGAACGCATTACAGGCGTGGCCGCGCCATGAACTCTTCCACGTACGCCGAGACTGGAACGCGAGTGCGGATATG
CtcgctggacaagcactACAGCGTCAGAGTGGGGTGACAGTTCGTGACCTGGACGAGATCCAAGACCTTAAGACGCTGAATCGCCTGGGAGAAATCATCC
GACCGGAACTTGGAACGTCGGATCGGTCGCCTCAGCCTGAAGATCAGGCCGACGCAGAACGCAGAACGGCGCAGATATTACCTGTCGCCACGCGTTCCAC
CGCTGCTCGAGCCTCGACGCCAAGAGATCGAGCGCCTGAAGCTCTACAAGAGCTCGTTgtacagcagctccgactgGACCGCGTCCGTGTCGCGCAGGAC
GAGGAACTGTGGATCGCGAATCCAAAACGATACTTGAGGGGCAATCTCGACGAACTTTCACGACGCGAAgcgaagaactgcagcaagatCGCCCACCAGT
ACGAAGAGGGCGAGAGCGGGCTGCTCTACTATC