Description :
From Genome Similarity Track
Location :
scaffold_981:525- 2266
Transcript NameFunction/comments
g10760.t1 hypothetical protein PHYSODRAFT_342550

Sequence
1741 bases(100 bases per row)
GCTACAACGTATATGGTCCAAGTGACTTCAAGGCCCCATCTGTGGAAGTCGCGCAGAGCTCTGGCTTCGGCAAGAGTCGGATGATTCGGGAGCTCGCGGT
CAAGGCAAAGGACGACCAAGAGCTGAACATGAAGGTGCTGTACACGTGCATTCGTATGCGTAACTCGACGGGGTATCCCAAGGCTACACCCGAGCTCATC
GACTGGCTGTTCGAGAAAGGGTCTACTGTCCAAGGCATCGCCAAGCGGTTAAAGGCGATATTCCACTACGCGATCGACCACTGGGACACTGTTCAGACGC
AATGGCTGGGACTTTTCACGGACACGACGACGGATGGTGTAGTGGCAAAAGCATTGGAAGAAACGCTGAAGCATCAAGAAGCCAAGGCGACGGACAAGTC
AGCTAGCAGAAAGAAGAAAGCGAGTGATAAACTGGTGCTGGTAGTGATCGACGAGGCGAGGCACCTGGTGGACAACACCACGAGCGGATTGGATCATTTT
CAGACGCTGCAACGCGCTCTCGTTTCGGTGAACAATAGTATTGGCAAGGAGGGAGCGATTTTCGGCGTGCTGGTGGATACAAACCCCAGAATGACGCCTC
CTGACCCATTGCCGCCACCTCACAAGGTGGACTCGTCCTGTCGTGGTAGCTACTTCAGCCGAAACCTGCCGTCGTTCCGACCTTTTGTGCTGACTCACAC
TATGGACGCGTGTTGGCAGCAGTATTGTCGGGATCAACTTGAAGACGTGAAAGGTGTGTTAATGGATACGCGTAACTCGGACGATAAGACAAACGAGAAA
CGGGAGAGCAACTACGGGTTGGGAGCTACTGACGTAGCCAAGGAAGAAACAGAAAAGGAGGTCTCAATGAGCGACCAGCTGACTGTGTACAAGCGTGTTG
TGGCGGCTGGAGACGAGAACGAGGCTTGGGACGCATTGAAGCGCATGGGGCGGCTGTTGTGGCGCTCTACAAGGGTCGATAAGAGTCAAATGGTCACGTT
CGCAGCCAATAAGCTGATGCTGGGGGTGGGCCCATGGAGGGAAAGCCACTTCACCGTCCACACCATGTTTGGTGTCGCGTCCATGCTGTGCAGACTGGGT
GTGCGTCCATGTTCGACGTCGGCATTGGCGTCTCGAGCTGTGGCAAATTTCATGGCGACTTTGGCCTATGTGACTTTCAAGAGAGACGCCTTCCTCAGCA
GCTACACTTCGGAGCCTGTGCTCACGTTCGGAGCGGTTAAAGTCTGGTACGAGTGCAATGATGGTCTCGTCAAGTACATTTTACCTCAGCTGAAGAAGTT
AATTTTGAGCGACGTGCTGGACTCTGGTGGGGTTGAAGAAGTAGTGGCTTGTATTCTGATGCTACTCGTGATGGACAAGTGTGTGATGGACGACTACGGG
TGTGTAGACAACGGACGTATTGGCGAGCTAGTTCCTGTGGAGAAGTTTCTGGAAGTGTTACAAGTCGAGAAGATGCAGCTATACACGAAGAGGGGAGATA
CAACCTCAGCCGATGCAAAAACAACTTTTGTGCAGTGGTTGTCGAAGTGGAAGGACTGGTACGTGGGGTTTACTCACTTCGTGCAGTTGGTGCTGGAACC
GGATGAGGACACGTTGTGGTATTTGCTGGGGCGTCGGGCCGCAGGTGTCTTTCCACGGGGCCAAAACGGAGCTTATCTGCTGATTCCGCTGTTTAAAAGG
CAGTCAGAGAGCGAATTGAACGAGAAGACGGGGGAGGACCT