Description :
From Genome Similarity Track
Location :
Scaffold_650:525- 2139
Sequence
1614 bases(100 bases per row)
TTCATCCGGTTGTTCTTGCGCATGGTAGAATTGTCGATCGACCGAAATTTCGGTTCAGAATTTTTTTTCATCAACGCCTTCCAAGTAAATTGAGTCAATC
TGATTAGTTAAAGATACCAAAATCGAGCTGGAAAAGCGATCAGACCACCGAACACCACGCACTTTTCTTGATCAGGAACTTAATTTTGGAGTTGAGCTGA
CTCGACTCGTCCGATCCAGCTACCTGCTCGATCTTCTCTATCTATTCCTGAAAAATTTCTCGAGGGCGCATATTGCAGACATACTGGTTCTTGAAATGAC
TTCTATACCACCAGACGTTGAGTATGAAGTGTCCATTTGTACAAATTTGGGTTCATCGACGATCTTGAATTTTCCTAAAGATAGATCGAACTTAACTTTG
TACACCCCATCTCGAATAGATCACGCATTGGACGGCCCCGGTGACATTCGGGAAATGCCGATCGACTCTACTGATACGATGTCCGAATGAACCGAGGCAT
ATTATCCTGAATAATGTTTCGTCGGCGTGTCGTAAGGGGCAATCTCGACTCCAGTCAATTCGAATGCCTACGAGAGAAAATAGTATCTCGACGAAAGCGT
CTACTGCGATCTTGATCTGATTCATACTGCATTCCATGAGGTCTTTTATATCAATAGCCTACATAGAAACGGGTATCTGCCAGCAGTCTAATTAATGTAG
TGATGGCGTCGACCTGACAGAAAATTCGTCCAGGCACTGACACCGGCCTACAAAGCGATCCAATTGATCTCAGCTGTAGAATGCTGAATCCAGGATTTTT
CATAAACAGTTTCTTCAAAGTGTACCAATGGTATTCCTACTCCATGCGATCCCATGTTCGAGTCGCTGACTCGATTTTTGACACTCCGATCTGCGAAAGC
TCTTGCTTCTTGATATTTTTCGCGTTGCCCTTCAACGTTTTCTGCCTTTTAATCTTTTTTTGACCTTTACCCTCCGATCCTGGAGCTCGTATCTTCTGTC
GCACCAATCCGTCAGAATTCTTGGTCTTCTTCTTCGCCTTGACATATGGTGATGTATCGACGAAGGCATAGGTTTTGGCTTTCGCCGTTGGACTTTTATC
TAGCAGATCGCCCTTTTCGGACCAATTTGCAATGGGCCCCGAAGAGACCTCAGGAGGGGGTCAAGGTTTATCTTCCAGATCGACAGATCGATCTTCCTCT
TTAATTTTTCTTGTCATCGAAGCCCGTGCCAAACCTCTGGCAATCTTGAAATCCTTCACGCGTCCGCGGCGGTCTTTCTTCTGCTGACACTTCAATCTCA
TAATCTGTCTTGATCGTAACATCTTCATCACGGGAATCACGGAAAATCCCAAGTCACCAGAAGATTCAGGCACGCACCCCAGTGGGGGTTGCTCATTTTT
TGAGGCAATCCCAATTCTCCACTGGCGCCCAGACTACCGACTAACGGAGGGATTACTCCGATTCCGCTTGTACTTGTTCCTTCCTCACCTTGTGCACCTG
TCGGTAGGGCGGGCTGCACTCTTCTAGGTGGACTTGACTCGATGCTGAACTTGACCGTTTTAGAGATTGGTGTCGATCGGGTGGGAATTCCTCACCCGAT
CGCGTGTTCTTGAT