Description :
From Genome Similarity Track
Location :
Scaffold_18:52493- 56314
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.28Ferric reductase like transmembrane component
Pytve_DAOMBR484maker-pve_contig_18-snap-gene-0.49Leucine Rich Repeat family protein

Sequence
3821 bases(100 bases per row)
TGATGGCGTGCGAGTAGTCGACCCCCATGGCGAGCATCCAGAAGCTGTTGCGCGTGGCCGGGAGGATCAGCAGCGAGAAGCACAGCACGGCGTTGAAGCC
GAGCGTGTAGCCGACGAGCTTGAAGATCCCCACTCCGTCCGCGGCGTCGGCTTCGACCAGGTCGGCGTACTTGCGCGAGAACACGGCGGCGAACCAGACG
GCGTTGAGGCCGAGGAAGACGATGGTCGTCAGCGACTCGGCGTACGAGATGTTGACCATGCCGACCATGATCTTGCGCTTGAGGAAGCGCATGATCGTGC
GGTGCGCTCCCGTGGGCACCGGCGGAAGCGCGTTCCCTAGCGCGAGCACCATGCCGCCGACCATGGTCGGGAGGCCGATGAACACGAAGTTGACGGCGAA
CTCGACGACCTCGCGGTGGCCGCCGACCCACTCGCCGTCCTCGACCGACGAGCCGAAGAGGTAGTAGATCTGGTAGCGGAAGCCGAGGCGGTACTCGGAC
ATTTCGTGGTAGATGTAACCGAAGAGCACGATGAGCGCGCAGACGGCGACGACCGTGAAGGGCCACGCCTTGTAGTTCTTGTGCACCGGCGTGCCGTAGA
CGAAGGGCGTGGCGAGTCCCGAGGGCTTGCCGCCCGGCCCCGCGCCAGGGTAGTTGGTGCCGCTCACGCTCAGCGCGAAGAACTTGCTGTCGCCGTTATC
CGTGCCCTGCGCGCGCAGGTCCATCGACTCGGCCGGCGAGCTCATGACGCTGCTGTCCATCGAGTAGTTAACCATGGTGCCGGGAGGGGGAGCCGTGCGC
TAACTGCTGGAGGATAACAAGAGTGCCGCTGCGGAAGGATAGCGAACGGTGTGGTCGGCCTGCCGGCTTGCCTGCCTGCCCGTCGGTAGCAAACGCTGAC
GCCTCCCACTATCCGGGGCAAAGGGACACTGAGGTTTTGCCGGCCGTCTCCGCCCGCATCCTGACGGTGGGCCGCCAGCCAGCCGCCGCTCCTTTCCGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGACGGACCGGGGAGAGCTGATGCCGATACAGACCGACGGTTTCACGTGCGGCGTGGCCAGCTGCCA
GCTGCTGCGAGACCGCCAGCCAGCGAGCAAGAACGCCCTGTGACCGCCTTCTGTGGTTTCAGCCGCCGTGACGCGGCTGCCAGCTGGTGCCGTCCGAGCG
CGCGCACCCCGAACCCGCAGGATAACAACCCCGACCTGAACACACCGGGGCGAGCGCAGATGGGATGGGGACTGGCGAAAGCGGCCGCCGCGCTCCACAA
GGCTGCTCAGCTCAGCTCAACAAACGCGAACCTCGAGACATCGTCCGCTCGCAACAAAGGTGGCATTTCGGGCAACGTTGGTCCGGTTGGAGTCGCTAAA
GAGCCTGTGCGCGAGGGATAGGGCTGACGCGCCACCAGCTGTTCCCGCTGAACGGTCGGGTTCATCCAATGAGGAGTGACTCATGCGTTCCTAGCCGGTC
GGCGCGCCACCGATCGAAGTCAATATTGACTACTGCCACCGGTTCTCATTTCGGCGATGTCGAAAATGCTAAAGACACGAAAGCAAAACCCGCAAAAAGA
TTCGACCAGAGGCACCGCAACGACATCTCGAAATGTCCACACGGTCGCGACGCCACGCCCAAGTTACTGGCAGTGACGACAGTAGCTCGCCCCGGAGTTA
CCGCAATGCGCGACGACGCCTCCGCCGTTCCGCCACAACCGGCAGCGCTGGCGATGGCGGCGCCGCCTCTACAGGTACTGCAGCCGCACAAAGCCGCGAG
GCACGGAGAAGCGGGTCGCTCACCACTTGACTGCCTTCTCGTGTTTGGGTGGGACGCAGAGACCGAAATGATCACGATTCAGGCGGCGAGTGGGCCGAGC
GCATCAAGGACGGTCCGATCGCGTGCGCTGTCAAATCTGCAGCCGATCCAAGAGATGCAGTCGCCACTGCCTGCAGCTCGCGACGGCGCCAGCCGGCGCC
ACCGTCAGCGCGTGACACTATGCGAGGTCGGAGAGTGTCACATGATGAGCTTCTTGCCAGCTGTGCCAGATCGCCTCAAAGTTGAAGCGGTCTGCAAGCG
GTGGCGCCACCTGAGCCATCAAATCCCGATCGAGGTGCTCGAGTTTGATGCCGTGGCGCGACGCTCGGTATCCAAACGCGCGCTGCTGCGGATGCTGGAG
AGAGCGGACAGGAATCTGACGCGCCTTTCGCTTCCGAATGTTCGGATTGAAGATGCCCACATGAAGCTCGTGTTCCGCCAGAGTGAGCTGCGATGCTTTC
AGGCACACAGGTGGCGAACAGCGAGAAGTTCAGAACGTGGCCTTGGTCACAGATCTTCGCTTATGGCGCTTGTTGTGCGTTCGTGACTGTATCAGACTGC
AAAAGAAGCACATTGTTGAATTGGTGAACGCCTGCACTAAGCTACAGGTACGACGCTTCCGACAGGCTAAGCCGTGTGTGTGTACTACCGAATTGCTTGG
CGGCCTTCGCTGACGGTTGTTGCTTGCTGTCATTCGCAGAGCCTGAGCATCCAGGATTGCACTGCCGTCCAATTTAGCGGGTGGAAGTCTTGCTCCACTC
CACTGCGCGACGTCTCTCTGTATCAATGCAACTTTATGACAAACAATACTGCGAGGACGGTGATTGCATCATGTGCAACGACTTTGAGGAAGCTGGTCAT
CACAGGTATGCAACTCTGCGTACACGATCTCGAAATTGTTGTTGGCACCTAACGTGCGCGCTCTGTTTGGGATATCAGGCGCGCCGGTCCTGCACTCCCA
GTTGCTCCGCCAACTGTCTCGTAGTGCGATTGATCTGGAGGAATTGACGTTGAGGTTGGTTGGCTGTTCGGTTTGTCAGTTTTCGATGAGCCATATCGTC
ATTACTCGAAATCGTCTGTCGTGCAGTCAGTGCCATTCTATCCAAGCCAACGACCTCCGGTTCTTCGCCGAAGCGTTCAGTCAATCGCTTCGCTGGCTCG
ACTTGTCGGCATGCCGTGGCATCGCATCATTTCCGGTTCGTTGGCGTTGCGTCGCTTTGTTATTGGTGTCATTGTTTGTCGTCATGCTGCAGAAGATCTG
ACAGTAACTACATTGTAGGCGCAACCATTGCTATCCAAGCTGCAAGTCCTGATTCTGGACAGAACGACACTGGACGATGCGGTGCTCTGCTCGATCGCAA
ACGTAGCGCCGAACTTGAGATACCTCTCACTTCAAGTACGGCGCACTGACTTTGCTGAACGCCACGCTGTGTGAGACTCGGCAAGAGAGTAGCAGGCTGA
CGTTGCTGCCTTTTGTGCTCAACAGGACTGCCGAGTGATTTCTGACGCTGGCATTAGCGCAATTGCTTCGCCTGAGGGCTGCGTCAACCTATCGGTGATT
GATGTCAAGGTAGAGAGGCAAACGCTTTCCTCATATTGACGATGGGGTTATCTGACAATGGATGTCATGGGATTCTGCTTGCCATCGTCACGACAGGGCA
CCAGCATCACAGACAGCGGACTGACAGCGTTAGAGAAGGGATGTCTGTCGCTGCGAATGGTGCGGATAGATTCGTGCAGGTCCGTGTCGCGCGAGATGCG
GCAAATGTACAATGAACGCTCGCGCAGCCACGTCCTCAATAACGAGCTCAACGAGTACGAGCGCATAGCGATCGAGCGCCAGCGAGCTGAAGACCTGTCC
AAAGTATTGAGCAGCAGCGAATCGGAAGGCGGCGGAAGTGATGAAGATTACAGCAGCGAATCGTCGTAGATTCTGTGATGCACATGGATGCCATCGACTA
CAGGTGACCTAGCATTGCTAC