Description :
From Genome Similarity Track
Location :
Scaffold_724:5248- 8496
Sequence
3248 bases(100 bases per row)
TCTCCAGTTAAGGTCTGGGCGACCACGTGTGGCACTATGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTAAGATCTAGGCGACCGTGT
GTGGAACTCTGTTACCCACCCTGAACACGCTATTGTCAGTGTTCGTGACAGCTGCAGCTGTCTGCGGAAATAAGTTACCCGCTTGTGGACCTAAGTTACC
CACTTGGTCCGCGCCTCCTCTGGGCGCTGCCACCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTC
CCAGTAGGGCCCCCCCTGCCCCTACTGGTTTCCGGCGCTCCCCTGTCCTCGGGATCCTGGCTTCTGTCAGCGACCCTTGAGGACGGCTTGGGGAAAGACC
GTCTGCGGAGTCTTTCCGCGGAGGGACAGTCGCGCTTAAAGTGGCCCATCTTCCCGCAGCTGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTC
CATGGGAACTGGTCCGTTGGGGTTCGTTCGACCGGGAGTCGACAAGGAATTCCCAGGCCACGCTGAGACCGGCGTACGCGCCTGGCGATGACTGTACTCT
TCTTGAAGAGCCACTCGAATCGCCTCTTCAAGGGTGTTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCATCCATGAGCACAG
TCATCTTGATTTGTTTGTTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCCCCCGTATCTCTTGCACGTACTCGTCCAGCTCACGCCTCCCTTGTTTGCA
CGAGAGGAAGCGCGAACGCTAGCGGTTCTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCACACAGCTGATCCCAGGATGTGAAACATCCAGGG
GATGTTGCCTCCCGTGTGTACATCCAACTCTTAGCACGGCCGCTAAGGTTTGAGAGTGCAAAAGCAGCACGAAGTTACTCGGTCGAGATCAGAGCCGCGT
CCATCGCGAGCTCTACTTCTCGGACCCCGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTAACCTTCAGCCGTATTGGCTTCGGGTGAGGCGG
ATTTTCTTCCGCCGCCGGAGCCTGCAGGCTCTCCCGCACATGCGCGATGAGCCCCTGCTCGTACGCGTCAAACGCATTGACGCGCTCGAGCTGCTCGGCC
GGTGTTGACACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATGGGAGACGTCGT
TCCTATTCATGGCAACGAGCTTCGGAGAGGTTCAGGTAGTCTACTCGCGGTGGCGTGGATTGACTACGAGTGCTACCAAGTGTGACGGGGTCACACAGCA
CCTTGCGCTAGAGGAAGTTAGCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTTTTATCGAAAAGGGAGCGAAGTGACCTATT
TAAGGTAGAATGTAAACTGAGTTTATTTATAGGTAGATAAAGCTTGGGTTTAATACAAACTATAAGTCACCTATAGAAATGCAATGTCATCAACCAATGG
TTGGCTTTGGACGACCTTGGTACCTTGTACCAAATATCCCGAAGTATGACGTGTCATACTTCATGTAACCAGGGGTACACTTAGGGCTACGTACCCCGTT
ACACGGTCGATCTCGGCTTGAAGCTTCGCGTTCGTCGGCATGGCTCTTTGTTGTCAGGTTGCTGGGACCAAAAAGTGCTATCAGTTTATCGAAGTCAGGG
GAGCTTGGGGGAGAGCGCGCCAAAAGAAAAGTGCCGTCAGACGGATGGAAGCTTCTAAAAGCTTCCACAGCCGTCCTACATCTGCCTGTTTATTAATTAC
AACACTTTATATTTCATTGTACTAACAACCCATTGCAATAAGATAATAATACTACCCAATCGGATACACAAGCATTCGATGTACGGGTTACTCCGTGAAT
GAGTCTTTTTGTTAACTTTAATACTACATGTATTGTGCCTTTCTGTTTTTTTTGTCCTCCCAATCGGACTTCTTATTCGGACTTCGGAGCCGTAACAAGA
GATCGGTAAAATGAGGGAAGGTAAAACGCAAAATTAACTATGTGGGCCATATCACAACTCCCTGCCATCCAGTCGCTTCATTTCTCCAATAGGAACTGCA
GGAAAGCACACTCTCTCGTAGAGAAGCGCGGTTTACAAACTAACTAACGTGGTGTACGTAGCAGGCGGCGCACATACTCGGGCGAAGGAGCGTGCAGAGC
GTGCGGAGGTGCTTTCGGATCCTGAATTGGACGGTGCGTGAGTGACAATGAGGCGGCATGCTGTCGGTTTTTTGCTATATATTTTTGAGCGATGATGTCT
AACACTGAACTGTTTTTCTTTGTAGGTGACTAACCAGGTCGCGTCTTAAAGGGAAACAACAACGCATTTGCGGTGGTCAGTGTTGCGGTGGTGCTGCTGT
TATTGTACGGGTGAGTGAGCACTCGCAAGCCGTCGTACTGCAGAAAACTCTCATGGATATTGTTGATACAGCATGATCTAATACTTTCTGCAATTGTCGC
ACAGGTGCATTCAATGGGACACTCATTCTCGCTGGTGTGTTTCGAGCCGACCAGCCATGTTTCCGCAGCATAGACCTACCAAAATCAATAACACTCCTCC
GGTCAGCCTTTCTTCAATGTCACCCACCGATCTGCGGGCTCTAGCCCA