Description :
From Genome Similarity Track
Location :
Scaffold_487:5248- 8017
Sequence
2769 bases(100 bases per row)
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGGTGCTGTCTGCGATGCATTCGACGTGCCATAGGCAGCGATCTGTACAAACA
GATGCTGCAGGCTGCGAGCGAGTTATCGCGTTTGAATCACGTCAGCTGAAAGCTGCTAAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGA
AGTATGCACTCGTCAAATTCAGAGTCCATCTGCTTGGCTTCAAGCCATTTGTCGTCTATACGTATCATGCGTAGCGAAACAGTCGCCTCACCTCTCTCAG
AGAATGGCTCAGAGGATTCCCTTCTTTGCGAATATAACTTCGAGGTGAAGTATGAGCCAGGCAAACAAAATGTATTGGCAGATGCCCTCTCCTGCATGCC
TGATTATGAGCTTGCTCATGTCACGACGTTGTCGTCTCCTATTGAGGAGTTAATTCGTGTGGCATATCCACGGGATTCTCAATGTGTGGCATTGTTTCAT
GCCCTTAGGAGTGAGGGATACAAAGACTTGGACAGTCAATTATCGGCACGATTGCGGGCCATTCTACATCGATATTCCATCGATAATGGCCTTTTTTGCT
ATTGCACAGATGTAGCGGATATCGCTCGCGTTGTTGTACCTCACGATGAGGATTTAAAGTATCGAATCCTCTTTGAGGCCCACGATACTGCCCTCAGTGG
ACATTTGGGCCGGGAAAAGACTTCCGGCTCTGTGAGTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCGCATACGTGCGTACATGCGAAACG
TGCCAGCGGGTAAAACCTTCAGCACATTTGGCTGCGCCTCTCTCCAGTTTACCTGTCCTCACGGTGTGGTGGGAGTCCATCTGTTTAGATTTTTTGTTTG
GTCTTCCCAAAGACTGTGACGGTAATACGGGAATTGTGGTCTTTGTTGACCGTTTAAGCAAGATGGCTCACTTGGCGGCGGTGCCGGATTCCATCGATGG
CAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTTGTCAACACGGGTTTTCGCTAGCAATCATCTTTGATCGTGACCTTCGCTTCACAGGCTAGTTT
GGACTTCCATTTTCAAGGTGCTAGGCACGCGATTGGACGTGTCTACAGCGAATTATACGCAGACCGATGGTCAGACTGAGCGAGTTAATCGCGTCATTGG
CGAAATTCTTTTTGCAGTGTTTGTGCTGAGTCGCCTAAGACTTAGAGCTCGATGCTCCCTGTCATTGAGTTTGCGTTGAACAACGCTGTTCATGACTCGA
CCGGCTTTGCCCCCTTCTATGTGAATAGCCTCCACACCCCGTGTTCCGCTCACGTTACTACTTCATGGGTCCTGGGCTTGGTGGGGGAGAGTCTGTTGAC
AAGCTTGATGAAATCAGCCCTACCACGACGCAGAAACAAGTTAGGGAGTTTCTTGCGACGCGCTTTAGTGTCTTACGACATGTGCGTGAAGCAATGGCTG
GAAGCCAAGACAAACAAAAAGAACAAGCTGATGCTTAAGGCAGAGGATGTATTGATTTTTATGAAGTTGGAGACCAAGTCTTATTTAAATGCTAAAACCT
ACCTACAAATGTAGTGTCTGCGGTCTTCAAGACGAAATTGCGTCCACGCTTCAGTGGGCCGTTTACGGTCATAGCGAAGGAAGTCCTTGCCTATACACTA
AATCTCCCGCGCAAGTTGCGCACACACCCAGTGTTTTACGTTGGCTTGCTTAAGCCATATCATGGTCCT