Description :
From Genome Similarity Track
Location :
Scaffold_136:52469- 61006
Transcript NameFunction/comments
Phyta_totarag4348hypothetical protein
Phyta_totarag4349hypothetical protein PHYSODRAFT_311081

Sequence
8537 bases(100 bases per row)
TATTCGACGCGGCTGAATTCCGTCGTGTTGGTGCTTGGGCGGTAAAACACGAACGAGAAGCCTGCGTGGAACGGGCCCGGATGGAAGACACCTACGGACG
AGTAGCCTAGTTGGTACTGCTCGGTCGAGTCGCCGAGGATCAGCACGTCCGGGGCcgggaagagctgcagcgacaagTCAAAGTCCCAGTTGATCGGGTT
CGCCATCAACGGCAGCGGACACAAGTGCGCTTGGTCGATGAGCGTCTTGGCCAACTGAAAACAAGCAAGTACACAACTCAGCAACAAGGTCAACGCCCCC
ACGTCAATCACGACAACATTAACCGTACATGTTTGGAGATGTCTGTCTGCGAGACTGACTGGGCAGCCGCACCGTCTTCGCCCATTGccgcttcgtcttc
ttcttgctcactTGGCATCGGTGGCAGAATAGCATGTCGTTGCATCTTTTGCTGGAGGTCATCACGGAAGATCACAATATCTTGTGTGTAGTAGCGGATT
CGGCACGGGTTGGTGCTGCAAGTGACGTTGGGCACCTTGCGGATGAGCTCGCGAGTGCAAAGATCAGGAAGCTGTTTGCAAAATATGTTGAACAAACACA
TTAGCTTTTTTCTTACTGCAGCATACTTAGAACGACATTTGCAAGTCTTACCGGGTGACGTGGGAAGGCGCGCGACGAACCCGGATCGTTAGGTCCAGGC
ACCAAAACAAAACGGGAGTTTTCGGCGATACCAGGGTACTTTAGAATGAGGTTTCCAAGCTCCTCCAAGTACTCTCGCAGATCCTGCAGCGAGTTGGATC
CGGCTCCTCCACCGATAGACGCCGACATGAAATCGCCCATGAGGATGAAAAGCGTTGGCTGCACACTCTCGAGGCCCTGAAAGAGCTCGTCCAACTTGCT
CATGACGTTTGGGTCGTCCAGATGGACGTCAGACAGCACAATGAATGTGGCGTGGTGGTCGTTAGCTTCCAATTCTCGGATCTGTTCGCGTTGCTGCACT
GACACCTCCACACCTAGAGGGTCAATGCCACCCAGGACTTCTAAAGAAGCCTCCTTCGTCTCCGGAGGTGGGAACCCCATTGACTAAAGAAAGAGCCACA
GCACAGTAACAACGTTAGATATAACCCCACCTAACTCCAACAGCTTCAATCAATGAAATCCGCACCTGAACATGAAGCACATCATCGATCACTTCAcctt
ccaccagcaccacacaATTTACCGTGAAGAGACCGTCTGTGTAAACTGCGTTGGTAAGGTCAATGATAATCCGCGACGTAAAGTCTTCCAGGTAAAACCT
CTTGCGTTCGTCCTGACCCAGCATGCCAATCACGAGTCGCACTCCAGTCACAcccagcagcgactcaaTCCGCGATAACTACACACCACAACAAGGAGAT
AAACTCAACTTTTCCAGCATTAACAACAGTCATAACAACAGTAAACTCTGGTCCTACCTCCATGTGCATGTACTCCGTGGTGTTAGCCACCGCAACCGAC
GGCGGTGCAAACAGACGATTCCGCTTGACACGGAGATCCACCGACATGAATCTGTTCCTCAGCAACTGGATCCTGGCTTCGGGTCCAGCGTGGAGTCGAC
GGTGGGCGTCTGCTCTCAACTCGTACGAGTTGTTGTGCGTGTTGAAGTGCAGCCTCGGAGTGTCGAAGGCGCCGAACACTTGGATCTTCTCGAAGTGGTT
CTCAGCAGACACCGCCAAGAGCGTGTCCAACGCGCTCTCCAGGGCCCCCAGCGTCACCACGGACGTCGTCACTGAGCAACACAAAAAGCATCAAATTTTA
GTTATCTACAGTCGTTTTAAAGGATTTTGAGAGCGTAGACGCACTCTTGCTGCGGTCAATATTGTTCTTGATGGCGTAGAGGACATCGTCCAGCTGGAGT
GATGGCTCGCTGCaagtggaagaggaggtaTTGAATAGTATTAATTTAGAGAGACCGGGTCGGACGGAGTCGCCGTCTTCGATGAATTGTTTTGCAGCGG
CTACTGCATGTTTGGAGATGGAAATTAGATGGACAGAAGTGCAAGACGCATACATACTTGGTGAGCTCCTCCGTAAGGCGTCGCAGAGCGTCGGCGTGAA
GTGACAGCCcctgcaacttgcacgcACGCAAAACTCGTTTGGACGCCATGGTGTTCCCGCGTTTTTTGGCTGGAAACGGTGGGCcaaatgtatccatgta
CCACTATTTGGGAACAAAACGACATCTcatgatggctacattccACAATGGTGTAcatgttgcagttgcagtgcaCTTGTACTGTATTATCCACGGACGC
AGTCTATACGGGTCTATGTGGTCGGTAGAGAAGAACATGTAAAGACATCCTTATCCCGCTCGTCAAAACTTGGAAGATTGGAACGATAGTTCACCCGCTA
GTACGTCTGGTTGCCTCCTTGGCCCAGTCCCAGCACATAGCTCATGCCCTGCGCATCACGCACGGCGGACGAGTCTCCCATGGCTGCCGACACCCGCGAA
AACGTGTTCCAGCACTGTGCACTCTGCGGTCTCGCACTCAGCCTGATGTTAAATGTAGTATAGAAAAAGTTAGAAGTGagtactgcagcttctcgcaaCT
TGTCAAGTTCGTACCGTTCGTTGAGGAGAAGTTTCACGAGTCGCAGGTCGTCACACTTGCTAGCGCTACAGGACATTGTCTCAATTAGTGTTGAGCACGG
TTGGAAGTCAATACGAGGCCGTCCGTACCATTCAATGAGAAgttgctccaccacgtcTTGGTCTACTTCGGTTCCGccaagaagtccaagctTTCCGCgc
actggcagcaacgcTTGGGTTGCATCTTTGAATCGAGCCTAGGATAATTCATCGATGATAAAGTAGCTAGTTAAGTGTTTTCTCCTCTATGCAAATAGAA
GAGCATGAACAAATTTGAGTGTCGTCACAAACCTCTGCGTACGCTTGGAAGCCCTTGCAAACGTTATTGTAcacttcctccagctccccTGACATTGCCA
AAAGGTTGTCACAAATGATTGTCAGTGTTTCCATGATGTTTCTGCAATGGGTAGAGTGGCGGGTTTACCTCGAATAGGAGGAAAGCTAAACTGGAACGGC
GTAAGGCCAAGCTGAGCCTCGAGGCGACCAGAGTCGACGGCAGGTTCCGAAGTCAGCGGTTCCAGTGGCGGTGTAGCACCGGAAGGCACGCATGACAATA
TGCTCTGCTCGAACAAGTGGTAATGTTAGATACAAAAACTGGTGCCGGCCGATTTACATCTCAGATACTTACGTAGCGGAGCACGTTCGCAAGAGGGTTA
AGACGCACTTTTGACACCTCATTTGCATATTTGCTTGAAGACGGCACCACTGCAGACCAgttctggagcagctgctcgcCTAACTCGATAGTGTCCTGGC
CTGCAAAGCGCAGTCTCCAGTAGAGCTGCGTGGCGTCGCACAGAATGGGTACTGCATGGGGAGCACCGTCGGGCTGATAGGGGAGGATATTGACCTCCAA
CATCTTGTCGATGCGAGCATAATTGCCCAGATCCAACATGTACAACGCCCACTGGAAGTACAGATGATGCTCCAGTGGTCCACCGTTGTCGAAACCTGCT
TTGACTTGGTTTGCGTAGCTCGCTGCGTGATTGGCGTTGCCTCGCGCTTCTAGGACGTGCAGCATGGTGTGCACTACGAAACCCAACACAACAGCAACCA
AATAACCACGCACAGCGTTAGCATGAAACGAAACGTATCAtccgccaccgccgtcaccacctccacttACATGCCCAGCGATCGTCGCCGTTCATggaca
gcgtcttctccgccaGAGCCTCTGCAGCATCCAACCGTCCGGCAGCTTGCATTCCGTACGCTTGCATACCCAGCAAGTGGCTATACCCAGCGTCATTCGG
AGACCAAGACGGCAGCCGACGCGTCACCGTCGCCAACATGTTCTTGTGGTCACTGCAATGCACACAACCACATGTTAACCCCCACACCAACATCACCCTT
GCACCATCACTTCCCCAGTCTCACCCAAGAAACAGGTAAACATcatagcagcagcgcatcGCCAGCAGGTCCGTGTGGTCGCGCAATAAGATCGTTTCAT
ACAGCGCAGCAGCCTCATAGTGGCGACCGTGCACCATCGAGTCCAGCGCCATAACGTGCATCTTCTcggccgtcgtcgtctctccTGCAAATACACAACA
CTCTCAGCTTCTTGGGGAATTTTTAAAGCCACCAGAGCCACCTGTCCCCACCTTCTTTGGCAATTTTAGTCGCCACTTGGAGTCTGGccgcagcatcaag
cgcGTCTTGATGCATGAGCGGGGCGAGACACTGGCTGGcacccaccagcacgtggccCATGAGGAACGgtgcgtcgtcctccagcacctgctgcagcatg
aaCTTCGGGTGCGAGTTCATGCTCACGTACtgcaacacacacacacacaagtTCGGTTAGAAACGTTGTTAGAAACGATCGCAATTGATATCATGCGAGC
CACGtacgtccagcagcgccacgtcgtaggcttgctgcttgctcgtgctgcgGCTCAGCGACGTGTTGCGCGCACCCTCGAACTCACCGATGCCGAAGAT
CGAGCCTAGCAGCGACATGGCGCGCGTCGAGCGcccacgcagcagcggaaCACCTCCGCGCCGTAGCATTGTGCGCTTTGCGCCGCACAATTTGTGCGTC
AGCATTCTTTGATAGACTATTTTCAATTCAcaaaaaaagaaaaaggAATTGGATATTGCTAATTATGTGTGCCACACTGGGTGGTAAATGTTGAAAAAAA
CTTTCATCTGATATCTTACATGCATATTTCGTTATTTTAATTGCTCTGGGCCATGCAAATCTGAagaggtacatgtagactcAAGTCTGATGACGAACGG
AGCAATGGGGACGGAGAGGtatgtattacatgtaccggtagaCGCTTTGCATTTTCACTTTATTTGATGATTTGCATTTTGGTTTTCAACACGCTACGCA
CACGACACTTGCACAACTATCGACGCTTTCTTTCGCGCCGTACACGATTAACACCGAAAATGTCGGCTGGACACTTGGATTATATGGAGATTTTCACATC
ATGTGCATGTTGGACCAAGACTGCATGGACGGATCGCCACCTTGAGAGGAACTGCCTTGGCTGCTGGGTGCAGCGGCGCCAGCATTTGCCTCGGAAGACA
TGTTCTCCAGAAGATCGTCCCACGGAGCCGCCTGACCCGTGCCACTGGCGTGATAAGCGTCTCCGGCTCGTGGAAAGGCTACCAGTGCGAGGCCACTTCG
CTGATCGTTCACAGCGCCTTCATGGCTAGCGAGCCCCGGTAGCatctgctgttgttgctgctgttggtgttgcagCACGTTGGCATATCCCATTGTCTGC
CTTTCCGTTTTGCCTTCCGAGTACGGCGAATAGCTGGACGGACGCAAAAAAGGCTCGGgctgatactgctgctgaggttgctgctgctgctgctgactgt
AATCGAATGAAGAGGCTGATGACGCGGGAGGAGAGAGACGTCCGTATTGTGGATACGCCGCAGATTGGTCCATTGACGGAGGCTGCAATCCGAAGCGATT
AACTTCCACGTTCGCTTCGGGCGggcgcatcttcttcacgggACGCAACGATTGCTCTGGGTGCTGCAGTAGAGCTGGAATAGACGGTCCACTTTCCTGC
TGCGTTTGACCCAGCACCGAGGAAGAATACACAGCCACACCAGTGCTCCACGACGCTGATACGGCATGGCCGTCGCTCGACGTGGACGCCAGAACGGGCG
GCATTGGCGTAATACTGGCCGTATTGGCAGGAGACGGGTGATGGTGCCAggacagcagctcatcgaacTGTCCGTTGCGAAGTAGCTGCATTGCGCGCTT
GCGTTTCTTGGCATCAGAGACGTCCAGCCCCATCACGGGCTGCCCTACGAGCACTGCAAACTTCAGCATGTTGCTCACCCAGAACTGCTGAACTGCAAGA
CGCAGGTTTTGCGTTTCGACTAAAGCGCCCTCGTCCGTGTTGTTTTCGCGCCGGAACTGATCCACGAGCTCCTGTCGGAAAATCTGTTCCAATCGAGACA
ACTCTCCTTGTCGTTGGGCATGGTCCATCTGGTCAAACTGTAGCGCCTTCTCACCTTTTCCAGGCTTGGTCACTCTAAACGTCCGTTTACCCAACGCATT
CTTCTGGAACTTCTTGGACAATCTCATCGTCGAGCAGTTGAGCAACTTGGCAAGCACCAAGCGGATGGGCGTGCCATGCGCCAGCGGCAGCGCCTGTCGG
TCGAACTCGCGGAGAATGCCGTCGATGAACTTCTCCTCGGGGCGAGTCCACTTTCCGCTGCGTGGCTCGGGCCGCACCATCATGTTGATGGTCGGAGAGA
TCGCTACCTGGTCGAGCGGCGCAGCGCAGACCGGACATGCGTCCATCGGCCACACATGAACGCAGCGCGAGTGAAAGGTGTGATTACAGTTAGGAACTAC
GAGGACAGGGTCGGGGTACTGACAGATATCGCACATGCGTTCCATGGGCATCGGCTGCTCTACGCGAGCCTCCGGCGTGGCCTGAATGCGGTAATCtgag
tgctgctgttggtaGGCTGCGATGGGCTTGTGCTCCAGCGGAGACTCAGCGTACGGGAACTGGGAGATGGCAACGGGCGTGCGGCTTGGCTGATAGTACG
GCTGCTGCGGCGTGTACTGCtgcggcaacggcgacggATGGTAGTAGGCCGGGGTCTCTAGCGTCGGACGCATGCTCGGGACCGAGGGGCGATCGCCCCC
GGCGCCACCACCGGGCTGCTGACTGTACTGATTGCTGTATTCGTATTCGTAGTTGGGCTGCTGGTGCCCACCACTTGGCTGCATTCTTGAATTCTTGAAG
CCTGACTCAAAGACTGGTGTTTGAGTCTCACAAATCATACaacgagctgcagtggcagtTGGCTGGTTGGATACGAACTGACTAAGCAGCAGAGACAACG
GCCTCTCGAGCTGAGTAGAGCTTTTGAGCAGTAATGGATGAATTCGAGAGTGAGGCTCAAGTCCTGGCCGAGAGCCTCTCAGAGAGGGGGAGGAGCACGA
GCGGttgctggctggctggctcAATTCAGCAGTGGCAGTATCAGGCGATACAGTACACACACAGGCCCGAGAAGGTCCAGGATTAACCCCTCGTTTTTGT
CGTGTCTTGTGCTTCCTTTCCCCTTCTGGCGTTGGCGTTCGGCAGTGGAGTTTCCTGTGCCGACGGGGTTAAGGAGAAGCCGCACAATCGCATTCGCAGG
CAAGGGCGATTTGCTGATGCCGCCGATTGTATTGTGCGTGTACGTGTACACAGTACATTAACAGTAACCCGAAAGTCTTtggttgttcttgttgctgttg
ttgccgCTTGCGTGGCCCGGTGCTAGCCCGTCCCACTACGACATCGGCTGTTGCAAAGTGGCTGTCCTCGAGGAAGCACGCTACGTGTGGGTCACGTCGC
GTTGAGTCAAGGCTGCAAGTCTCCGAAGCGGGTGGGACTGCAAGGGCCGGCCCGCTCTCGTTCGAAGTCAGAGGATACTACGCTGGACGAGccggtggcg
gtggcaccTGTGCCGCCcggagcagctcgctgctgccaggGCATCAAAAGCAGAGCCTACGTCCTGCTGGTTGGCTGACTGCAACCAAGTGGGTAGCAGA
CGGTCGGACGTCCCGATCCTCGATCGTGTTTGACGGAAAGGTCCGGCGGTGTATTgagagcaagagcaggatTAGCCCTCGCTCGACCGCCTGCTGGCAG
GCACGTACTCCGGCCCGATGTCCGGGCTCCGTGAgagtacagtaccggtaagcCTTGACCGGCACGGCTGATGTCGTTGTTGACGAGTGCGACGCCAGAT
GGGGGAAAGCCCTGGCAGCGGAAAGGAGTCGAAAAGCTGAAGCTGTGATAACGTCCCGGGGGCAGCCACGAACATGCATATCGCCTGAAGTAGCTCTCCT
TtcagctgctgagcttcagGATGATCTACTACTAAAAATGGGGAGACTTTGcggtgcaagttgcagtttgcccaagcagaggaggagaggGATGCACCCT
ACCTCACAGCTCCCACCCCCGCCACGTGATCGAAAAGCAAAGCACAGGTGGGTGACGGGGCCACTGATGGGTACAGCGCcacggttgctgctgcggctga
CAAACTTCGTGGCCGACAGCAAGCATTCACAAGCACTGAAGACGAGGCATGCGCGCTAGGCGTTCTTTAGCGCGACACTTTTGCACGCGGTGAACAGTCT
GCAATAGCCACTTTCGCGTGGGCTGGTTGTTGTTTTTTCGATGCGCGGTGGCTTACGGCCAAGTTCCATCATTAGATGGTGCATCGCCAACAGAAGCTCG
CCAGGAATTTCGTTTGTGTCCACCTTGGTCGCTTGCGCTGGATGGTATCCACCGAACGACCCGTAATCGGATTGTAGAACCAGCTTTGTTGCGTACCTAG
TTTTTGTCAAACAACtcggcgcgcagcagcgggCCAT