Description :
From Genome Similarity Track
Location :
Scaffold_58:52418- 53886
Transcript NameFunction/comments
Phyra_81255putative G-protein coupled receptor

Sequence
1468 bases(100 bases per row)
GTGCGCCGTAGTCGTTGTTGGCGGTGCGCGAGGCCTTGGAAAACTTGGTGAGCGCTAGGACGCCTAAGCTGCAAGATGAGCTCACGACGAACATGATGTC
GAAGTACCGATGGAAGACGTTGAACTCAATTTCGCCCAGCACTTCATCAATTCGCTGACTGCATGAAGCGCAACAGTACAACCACAAAGCAACAGGTAGT
TAGAGCCTGATTCATCCCCGTAACTTCTCCCAACGTACCGGTGCAGCGGGCTGAGATTCATCCGCATGAGGACGAAGGACGAAATGAAGTACATCCCCAT
GAGGTGTGCTAGCCAGAGCACGACGCTGTTCGACGACACGGTGCTGGAGTAGGCGCGGAAGAACTTGAGCAGCGTCACCAGAAAGCCTCGGGTCTGGGTG
AACACAAGAATACCCACAAAGCCGAGTGAAGCCACCTCCGACACGAAGCGAATATTCAGCTGCTCTGCCAGCGACGGCCAGATGTACAGCAGCTTCTCCA
CCACATCCGTGATCGGGTCCTTGTCGCGATTCCGTCGAAACACCACGTTCACGGTGCTCATTACCATCTTGTACATACAGAAGCCCGACATGACGTATCC
AAAGAAGTTGAGCACGCGGCCCCGCAACGTTCTAGCGCGAAGCGACCGCTCCTGCACGTCTCTGAGGTCGTTCACCTCGAGAAACAGCTCGCGTCCCAGA
CTCTCCAGCGTCAAGATCTCCGCCTCCAGCCCCTTAATGTACGTCGTGTCGTCCTTGGCCGACGAGAAGAGTCCGAAGGCTCGCGAGAAGAACGAACCCT
TCTTGGCCCCACCTGCAAAGGCCTCATCTTGTCGTCGGGCAGAGGCTCTGAGCTCCAGCGTCAGCCGCTTCTTCTTGGCAATGAGAATGTCCAGATTATG
GCGCAGCCTCTTCTCCAAGAACTCAATGTCCTCCTCGGCCACCCGACGCCAGAAGAACGTCATGTACTCGTACGGACAGTTGACGGCTCCAAAGCCAGAC
AGCAGCGCCATGAAGAGTACGCCCAATAAACTCACTCGACTCACAAAGTTCCTGATAGAAAACAACGCTAGCAGAACAAAATCATAGCAGTGAACAACAA
TATCAGTGCCCAGACCTCTCTATCTCGTCTCTCGTGCTCCGATTTGCCTCCGAACTGCTGCAATCAACTCACCGTCCACAGATTGCTGTGGTAGGTCTGG
CTGCAGCACGGACCCGAGCCTCCAGAAGCCGTAAAGGTACACTGCGAGCAGCAAAGTCGCTGTAAGGGCGGCCTTCCTCCTGTCCGCGCCGTGCTCCCTC
GCCAGCGCGTAGAAGAGCGACAGCGGCAACACCAGCACCTCCAGGTACGTCATTGCAATAAGATCCGCCCTCCAGACCCACTGGCGGCTGCGCGCGCCCA
TCACGTCCGTCACCTCGAACAAAACCATCTCGAAGAGGCTCAGGCTGAAGGTCAGAGACGCCGCGAAG