Description :
From Genome Similarity Track
Location :
Scaffold_5:5241265- 5244351
Transcript NameFunction/comments
Physo_562218scavenger mRNA-decapping enzyme DcpS, putative
Physo_508545PREDICTED: predicted protein-like
Physo_507451glutamate carboxypeptidase, putative

Sequence
3086 bases(100 bases per row)
TCCATCTCGACTCTTCTCTCGGCTTGTCTCTTTGTTGCTGTTGGGTCTTCTTCTTGAGGCTGGACTCAGAATCCTCAGACATCGAGTAACGGCCAATCAG
CGCTCGGTGGCGTCATCCCAATCAAAAGTGTATCAGGAGCATGGGGCTGCTGGATCTGCTGGCCCAGGTGGAGCGTCTGGGCGTGGGCGTGGCGCTGGTG
GCGGCCGTGCTGGGCGCGCTGTACGCGTGGCAGCAGACGGTGGAGGATGGAGGCTCCTCCAAGATGCTGCGCGACTTCAACCTCGTGCGCGTGCTCAAGC
GGACGGACACGGAGCTGGCGCTGCTGGGCAACTTCAGGAGCGACAACCACAAGAAGGCGGCGGTGCTCGTGATCCAGACGGCGGCCATGGACTCTGGCGC
TCTGGACCGAATGCTGGCGGGCATGTCGTTGCATGAGATCCTGGTGAACGATATCTACAGCACGTTCCAGGGAGACGTGGCGCGAGATGTCAAGCCGTAC
AAGGTGCGGGAATGTTGCAATAGGCGTAGGAAGAGAAGGAGAGGGATGGATACAATGTGTGCTGACTGTGAATGAATGTTGTGCAGGTGAACTTGATCTA
CCCGGCGACGGAGCGGCATGTGCGCAAGCACACGGACCAGAACTTCCACATAGTGGTGGAGACCAAGGAGGCGTACAGGATGATCACCAAGCCGTACATC
GACAGTATCCCTCCGGAGAACATCGAGTGGGTCTACAATATCTTGGAGCAGTAAGTGAGGGCTGGTGATTTTTGCTAGCAGGTGGCGAGATGTGGTGCAC
TGACCGCTATGTGTGTGTATGCATTGACTGTTGCAGCAAGAGCGAGTCGGAACGTATTATCTTCGAAGACTCGCACCCACGCAATGGTTTTCTTCTGCTT
CCCGACTTCAAGTGGTCGGACCCCACCAAGGTGCTTCCTTCGCTGTTGGTGCTAAAGGGTTTCGCGTCATGATACACTTACGGATTCTACTGTTTGATCT
TCCAGTTGGAGTCGCTCTATTGTCTGGCAATTGTTCACGATCGATCGCTTCGATCGCTTCGTGATCTCACGGGATCACACTTAAAGCTGCTGCGGAATAT
CCGGTACGTGGTTCCCTCTGTTTCGATAGTGTACATTGAAGTTGGCGAATCCTGATGTTGACTCTTTAACTGCGAACAGCAATGCGAGCTTGGAAGTCTT
GAGCGAAAAGTTTGGCGTGAATCCGAGCTCGATCCGCATGTACTTGCACTACCAGCCGACGTACTACCACCTGCATGTGCACTTCTCGCACGTGAAGATG
ACCCAGGGTGCGTTTCGAAGTGTTGCTTGAAGAATGTGGACCATGACTAACTTCGTTCGTCGTTGCTTCGCTCTGCGTAGGAACGTTCTCGGGCAAGGCT
GTACTGCTGGAGGACGTGATCTACAATCTTTCTGTCAACAGCGACCACTACAAGAACGCGACGCTGTCGTTCGTGGTCGGCGAGATGCAGCACAAGCAAC
TGTTCGAGCTTTTCCGCGAGAAGCGCATCATTTAATGCACGCTAGACAATCGCATTGCTCCAGTTAGATGCACTCTTGAAGGCGTCCGCACGGGATCATG
CCTAGCAGGCGCCTTCAAGAGTACGAAGGACTAATACCATGTGCTTGTTGGAGGTGTGTAATAGAGATACCGTACCCATTCGCGTAAAATACCAACTGCA
ACGTTCGTCTGCAGGTCACCCATCTCGAGCATACAATTGCCAAGTATAACACCAACGGCGGAACGCCTCCACCGGCGGAAAATAACGGTCGGTGGGCACA
TCCACAAAAATTCTCTTCGCCTCGGCCATTGCAGAACTTGCTCTGAACCCCACAGACAATCCGCCGGACGATCTCTCTCTCGCTCCTGTACAGCCACTGA
AAATGACGCTCCTGGAGAAGCTCTTGGGCAGCACGCTGGTCTCGCGGCGCGGCGAGACGTCCACGCTCGAGGCGCTGGCGCACAAGTCGGTGGTGGGGCT
CTACTTCACGGCCAGTACCTGCCACCCGTGCCGAGCCTTCACGCCCGTGCTGGCGACTGTGTACCGCAACATGACGCTCAACGCGTACAAGTCGCTGGCC
ATGAAGGAGCAGCTGGACGTGGTGCTGCTGTCCAACGACCGGAGCCCCGTGGCCTTCCACGACGCGCTGCTGCAGACGCCGTTCCTCGCCGTGCCCTTCC
ACCGACGCGACGTCGTGCAGGACCTGTGGAAGCGCTACGACGTCAAGACGATCCCGACGCTCATCTTTGTGGACGCCAACGGCGACGTGGTCGAGCGCGA
GGGCCGCCGCTTCATCGAGAATAACTACACGGACCTGCGCAAGATCTGGGAGCACCTGGCGCCGTCGCTCTCGTCGTCTTCGGGGCCGGAGACCACGATT
CCGTGAACTCTCGCGCCGAAGGAGTAGGGCTGCAGCCCAAGATATTGCTTAACCGTTCTAATTCGTATCATTACCACATTCTCTATGGTACTTTCTGAAC
CATGTTACTCGATCGACGAAGCCATCCTCTTGTCGTCGCTCATAAAATTCAGCACAGCGAAGTCCCGTCCAACAGTACCGGGCTGCAGCAAACGAAATGA
ATCAGTCTGCTTCAGCATAACTACCTTACTTCACCTCATATCGTTGATCCAATTTTATACAAAACCGTGCTCTAAACCCCGTGCTGGGCAGGAAAAGCCA
ACGTGCAGCTCCAGCAGAATTGCTGCGTATCCGGATAAGCTGGGGAAATGCAGGGCGGACACGATTCCTCGAGGGCTAAGCTGTTGACCACGTTGAAGCC
CATCGAGCCAATCACGGAGCAGATCCGCACCGCTTCAGCCTTGGCCCGATACACTCATCACGGTCTCACAAAGCATCACGTCCGGCATGACCTCTCCTCC
GCTCCACTCTGCAATCGGCGGCATCTCTCTCAAGCTCCAGCATGCCGTCCTTCCCACCTGCCAGCAAGCCTCGAGGTCCCGTGCTCGTCAACGACGACGA
AATCTACGGCACCTTCGACGGGCGTCCTAGCCTTCAAGACACGAACACAGAAGCAGCTAATGGCCCCTCCAGCACTAGAATCAGTG