Description :
From Genome Similarity Track
Location :
Scaffold_955:5241- 7648
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_955-snap-gene-0.1Sodium/potassium-transporting ATPase subunit alpha

Sequence
2407 bases(100 bases per row)
GTCGCCGCCCGAGACCGTCCCCAGCTATGTGCTGTTCCTGCAGCAATTTCTCGACATGTTCATGATCCTGCTGGCTGTTGCCGGGCTCCTGAGTCTCATC
TCGTACTTCTTCGACACGTCGGTGATGCTCAACCTCTACCTGTCTCTCGTTCTGTTTGGTATCGTGGTCGTCACGTGCACTATCACGTTTCTCCAAGCGC
GGTCGACGAGCAAGGTGATGGAATCGTTCAGGAGCATGCTGCCGCAACAGTGCACGGTGGTGCGCGACGGCGTAAGCCAAACGATTCCAGCGGAGGAACT
GGTCGTCGGAGACTTGGTGTGGGTGAGCAACGGTGACAAGGTGCCGGCGGACTTGCGGGTCTTGATGTGCAACAACCTCAAAGTGGAGAATTCGTCGCTC
ACTGGTGAGTCTGACCTCATCACAGTCACATCCGACGCGCAGAGCGAGTCGGTGGCTCATCTGGAGTGCAAGAACGTTGTGTTTAATGGTTCCTTGTGCT
TTGATGGATCGGCTTTGGGTCTCGTGCTAAGCATCGGAGACCAGACGGTCATTGGGCGGATTGCCGAGCTCGCGACATCCACGACGACAAGGGAGACGAA
CATGCAACGCGAGGTCAAGTCGTTCGTACGCTTCATCAGTGTACTCGCCATTGCGATGGGTGGTATTCTGTTTGTCATCGGCGTCGTTCGAAAGGGAGGC
GACGACGTGATCTCGACTTTCGTGAACGGCTTCCTGGTGATAATTGTTGCGAACGTACCCCAAGGTTTACCCGCCACTGTAACGTCGCTGCTGACGATTA
CAGCGAGTCGCATGGCTGCTCGTAACGTGTTTGTCAAGCGCCTCGACTGCGTAGAAACGATGGGTTCTATCTCGCTTATCGCTACCGACAAGACCGGCAC
GCTGACCAAGAACGTCATGACCGTGACGGACACGTGGGCTGGTCAGGAATTCTCCGCTCAGCATTCCGGTGACCACCTCGTGATCGAGTTGGATGACAAG
ACGGACTACTTGGTTGGTTGCACTCCGAAAGCGTTGCTATTTCGAGGGGCTGCGCTTTGCAACCGTGCTTCGTCGGACTCTGTGTCTCCTGTAACTGTTC
TGGGAGCTCATGAGTCGGAGGACCCAGAGGACGAAAAAATGGCTGGACTCGAACGACTCAGTCACCATGGAGCCGTGTCGACTCACTTCCGGCACAGTTT
CACTGGGAAACGTCGATACTCCGGTAACCCATCAGACATCGCGCTTCTTCGCTTCGCTGACTTACACCACTCGACTGATGTTGCGCGCCGAGAATATCCT
GTCGTCTTCGAGATTCCGTTCAACTCGATGAACAAGTGGCAACTAGTGATCGTTCCAGCACCGCGAGAGGAACGGTCGCACGGCAGATTCGACATGTTTA
TGAAGGGTGCACCCGAAGTGATCGTTAGTCGCTGCAGCACTTTCCTGAGTGCCGCTGGCGACGAAATCCCGATGACAAAAGCGTTTATGAGCGAGTTCTC
AGACGCATACGAGCTGTTTGGGAGCAAGGGGAGGCGTGTGCTTGCGATGGCAACTCGTCGTTTTGAATCTCGAGTTGCGGATTTCTCAACAGAAGAGAAC
AACTTCCCGTCGGACAACTTGTGCTTCGTTGGTATGATTGCCATTATGGACCCCCCACGCGACGACGTACCAGAAGCGATTGCGAAATGCAAAGACGCAG
GCATCAAAGTGTTTATGGTTACGGGTGATCACCCTGCAACGGCGCGGGCAATAGCGGCGGAGATTGGTCTACTTGATGGCGACGACAATGTGATGGAACT
GTTGTCGCCTGCATCGGCGGGTGAAATGAACTTACAGTCCAATTTAGATGCACAAAATTCTGCAGTCGTTCACTGCAATGTAATCGACCATATTTCCGAT
GATGTGCTCAAGACTATCTTGCGGATGAAGTCGGTTGTGTTTGCTCGAGCTACTCCTCAGCACAAGCTTCAGATTGTACAAGCAAGCCAGGAATTGGGCG
AGTGCGTTGGTGTGACTGGTGATGGTGTGAACGATGCACCTGCGCTCAAGCAAGCGGACGTCGGCGTGGCCATGGGACTGAACGGCAGTGATGTGGCGCG
TCAAGCAGCTGATATCATCCTGATGGACGACAATTTCTCGTCGATCGTTCGTGGGGTCGAGCAAGGTCGCGTGATCTTCGACAACCTGAAAAAGACGATC
GCGTACACGCTGACGCATTTGTGGCCCGAGATCATGCCGGTTGCAATCAACTTGGCGCTCGGAATGCCGGCGGGCATGACGTCGCTGCAGATTCTGAGCA
TTGACCTCGGTACGGAGCTTGGTCCTGCGATCTCTCTAGCTTACGAGCACGCCGAGAACGACATCATGCGACGACCTCCGCGAAACCTAAACAACGACTG
CCTCATG