Description :
From Genome Similarity Track
Location :
Scaffold_96:52402- 57810
Transcript NameFunction/comments
Phyke_g6353hypothetical protein PHYSODRAFT_349787
Phyke_g6354conserved hypothetical protein
Phyke_g6355hypothetical protein

Sequence
5408 bases(100 bases per row)
TCAAGGCTAAGCCACCTCATCTTTCACGCTTATCATGTCGCTCAAACTGCAAGGAACCTTTACGGCGCTCGTGACACCCTTCACGCAAGACGGCAGTGCT
GTCGACTACGCCAAGCTGCGCGAGATCGTGGAATGGCAGATCCAGGAGGGCATCAACGGCCTCGTGCCTGTAAGTACCAAACCAACTAATCTATTCATTG
CATATCGTAGGCTGTAACGAATTGTAATGCAATTACTGTAACAGATGGGCACGACCGGTGAGTGCCCCACGGTCTCCCACGAGGAGCACGACCGCGTGAT
CAAGGAGGTGGTGGCTGTGGCGAACAAGCGCGTGCCTGTGATTGCCGGCACGGGCTCCAACAGCACGGCTGAGGCGCTGCGTCTCACGCGCGCGGCCAAG
GAATGTGGTGCTGACGCTTGTCTTGTGGTGTGCCCGTACTACAACAAGCCCACGCAGAAGGGCCTGTACGCTCACTTCAAGGCTGTGGCAGAAGTGGGAC
TGCCCGTGGTTGTCTACAACATCCCCGGCCGGACCAACGTCAACCTGACGCCGCAGACGATTGCCgagctgaacaagctgcCCAACATTGTGGCTATCAA
GGAATCCACGGGCTCGCTTGACCAGGCCATGgaaattgctgctctctGCGACATCACCATTCTGTCCGGTGACGACAACCTGACACTGCCGCTGATGGCT
ATGGGCGCTACGGGTGTTATTAGTGTGCTCTCCAACGCCTGTGAGTATTTGGAATTTTGAGGGTGCTGTATTGCGCGATATTGatgtgcttgttgttgtt
ggaaaCAGCCCCCAAGAAGGTGTTGGCCGTCACGGACCCGATGCTGAAGGGCGActacgctgctgctcgcaAGGCGGCTCTGGAGAACGtacgttgaagc
tgcactcGCTGATTAATGCGATAGCTGTTCGCATGGCTTCTCTAACGATTTGCTTTATCTCTGTTGGTGCATACAGATCTTCCTGGTTAAGTCGCTCTTC
AGCGAGGCCAACCCGCAGCCTatcaagaaggtgctggagctcatggGCAAGTGCACTTCCACCGTGCGCGCGCCTCTTGTGCAGTGCGAGCCTGCGACTA
TCGAGAACCTGACGCAGCTCGCCAAGGAGCACAATCTTGTGTAAGATAACAGACCTAAGTAGGTTGTTACCTTCGTTCCTTCTATTGCAATGGTGTAAAT
TCAGTTGAACAAGCCAGTTGTGCCTAAGCTAGAGTTCTTCCTTCCAATTCAATATTGTTATTTCAATATGCACGCAAACGGAAAGAAGTGCATGCATGTT
ATTATGCTGCTTATAAGTAAACCATCTAGCTGTTGAAATAGTACGTGAACGCATACATTACAGTACTGTAGTATTAACAACTCGAACGAGTGCTAGGAAT
GAGGATTACTACGTGTAGTAACACAAGAAGACACTTGTTCACTCACTCGCTGACTTCTCAGTACTGCTTCCGTTCCTAGCACTGGGACGACAAAACGCCG
ACTACCGTACACTTATTGTTTCTAGTAATTGGAGCCGTGTGAGCTGTCCAGGTTTGAGTCGACGCTTAGTCCGCTGATGCGCGAGCCTTCACGGCTGTAA
GTAGACATACCAGAGCTGTACGAGTCAGCACTGGAACGCGACGGTCGGAACGAGTACGAGTCCACCGACACTTCACTCTGAAGACGCGATGCGCTCATAG
CCTCAGAAAAGCCAGTGGCACGGGAGTCCTCCGTCGCACGCGAGTCTTCAGTCTGGCGCGACTCCTCCGTTGGGCGGTAGTCTTCGGTAAAGCGAGACTC
CTGCGTCTCGCGTGACTGGTAGTCATCGATGTATATCTCTTCCGTTGGGCGAGACGCCATTGAGAAGCCCCCGTCACGGCTAGAAGCAACTCCACTCAAC
CCCGTGATGCGCGTGTTGTTCTCCGAATATGCTCCATCTGAGTATCCACTGACCGTGCTAAATCCCCCAATGCTGCCAAATCCACGAGCCTTGAGCTCAG
CCTGTTCCATTGAGTCTAGACGAGAGTCCATGTGGGATGAACCACGAGAGTACTCTGAGGTCTTCCAATCTTCGCCCTGCAGGTACTTGTTTTGACGCGC
TGATACAATCGAGTCGCCGAAGTTCGACATCGACGCTTCACTCTGGCTGCCGCTGGCAAGCGAGGAGAGTTCTGACATATTGCTGACACGGTAGTCCTCG
CTGTTCGCCTCGCTTTGGCCAGTTGCGCCGGCTGCACCATAGCTCACCTTTTCGGCATATACATCAGATTCCGAGTGCACGGAGCTGCCGTTGCTCGAAT
TTAGCTCCGAGCCACGTTCGGCCGAGGCCATGATAGCCACAGACGACTCATCACTCATGTTGGGTTGCAcattgctgtcgttgttgcGTGCTGAAATGTT
GGCGACGTACGTCAAATCAATCTTCTTACCAGCATTTGCGTCGCCGTTGAGGGCACTTTCGTCCATGTCACTAGCCATAGAAGGCGAGGTCAGGTCAAAG
GCCTTGCTCGCAGCCATGCGTTGTTCTTTACGGCGACGCATCACGAAGGCAAAGccgacaacaccaacaatACAGCAGCCCACTAACACTGCAATCAGAA
TCACACCGTTGGAGGCGAAGAAGCTACTGTTGCCATTCGAAGTCGAGGCCGACTTCGTTGAATCAGAGGAGCCCGTGTTGGTCTGGCCAGTCGCCGGGGT
CGGTGCTGTCGGTGTCTCTGACTTCTCCTGCACACTGGACTCATTCATACCGTCCGAGTCGTCGCCTGCAGAGCTATctgttgagctgctgccgagTATT
GTCGACTCATCCAAGCTGTTTCCGTCATCAGACGCCGAATTCGACGCTGATTTCGACGATGATGCCGACGGAGGTGCTGacgttggtggtgcagtcgtCG
AACTCCATTCGTTGGACCCTGTACTTGATCCCGACGTTGATGTAATCGGCGTGTCCGCTGACACGATCGAGATCTTCTTAAACACAATGTACTCCTCCGC
TGTGATAAACAGCGACGCGTCACCCGGAAGAGCAACAATTCCCACAACGATGAAGTCGCCCGCTGTTCCAAGGTTAAAGGTGTTGGTTTCCAGAGCTTTT
GTCCCGTCCGCGGCAAACGCGCCGCTGCTGGTTCCATCAGCACCTGTGGGGGCTCCTGCTACGTTCGTGGCGCAATTGGTTCCTGAAGTGCATGCCCACA
TGTTGGAGACCGTGACGGCTCCTGGGAGTCCTGAGGCGTCAATGGCGTTCGGGAAGATGGCGTTGCTCAATCCGACGTTCGCCTTAGCACTCCACTTAAC
AGTGACGAGGTCATTGACGTGAAATTGAGACGCCGTCAGCGTCATCGTCAGCCCAACGGGACACCGTCCGACGTTACTGGGGACTAGCGAGTCAAAATTC
AGAGTCGCTGTGGTGTTGGTACCCATGCAGTACGTCGTCGATCCGTCCTGTGTGAAGCCCGATTCGATGTCGGTGGCGACCGCTGCGCCCAGCATCATCA
CGGCTGCAAATACTGTAGACGCGACGTTCATCCTGTTTGAACTGGTAAATTTCTCTGTGGAAAAGTCAAATTTCCTTGTGCCTTCTACCTATCTGTTTGT
cttttgaagagcaagatggaTAGCCTAGTTAGTTCTCAATGCACCACGGTAGAAATCCGTATCGAGTTTTTTTGGAGTCCTTCGATCGGAGCAAAAAGAC
TCGAGTGCAAAAGCCCGTGTCTGGAAATGACCAGCTTTCAGACCAGAGTGAGAGGCCGGAAAGACGGCACGCCCACCCTGCTCTACTCACTGACTCGGGC
TAGAATGCCCAGTCTCTACGGGCAGACGATAGACAGATGGTTTCACCGCAAACCAAACCGCGCGACTCTGCCGGGGCCCAAAATGGACAAAATAGAGCGT
GGCGGACCTTTTTCCgagatgaaaatgctgtGCTGGGGACGATCTGCGTTTAAATTTTTCAACCATGGCATACATGAATATTGCTTCACGTCCACCATGC
TGTATCTGTAGACTTTTTTTTCCTTCTGAGCATACACCACCAAATAGCTATGTTCGTTTATTGCGAGATTTCCTTCCTTATAACGGGCGATGCATCAAGT
CGACGTCATGACTCATGTTGCCAGTCCACTATAGAGCGTTCTGTGCGAGAAAGTCACTCTGAGCAAGTTGGTCTTCGACAATTAAGACCTAAAAAATGAG
TATTGCAACCTCGTTCAAATCACGTCTCCACTCGAGCCGTGCAAGGCATATCGATACGTTTGGCGGCGGATTGAGCTGAAGGCTGGGGACGAATGGACAA
GCGATGGCTTGTTCCACTTTTTTGCGCAGAGATCGGCCGCAAGGTCCGATGTGTGTCATTGCACTTCGCGAATCGGCAACACACTGCTGAGCGGCCGCGA
AGCGACACAAGAGTACAAGCCATTTCCAAACTATAGCTTCGCCCTCGAATTTGGGTGCTGATCAGCCACAGTTCAGCAAAAGTATGTAGCGCTCATTTCA
GGCAAGCTTGTCATTTGCTACATTATGGTTACTACCGCCACAATGTTGTGGCCATGGGCTCCCTCTGGCAGATGATGCACAAGTTATTATTTTGTGCTGC
CGACGTGGTTCCCTACCAAAATGGTAATATGCCCAGCTGGCTCGTCAGACGATTTTGACGCATGTGGTGCATTACTTATGGCACTTTGTCCACACGCGCA
GTGCGGCCAGAATGCACGACAGCGCTACGGACGTTTGTTTCTGGCAGCCATCGCTCCATCTTCCTTTCAGGAAAGTTCACACTTGGCATTTGGCGGTCTC
CGCTCTGAGCGCACCACATTCGTGACCAGGAGGATTGCCAGATGCGCCAACCGGCTCTTGGCGCCAGGCACTATCCAAAGCCGTGGCATGCAATCTGTTC
AAATAAGACGGCACAAAAGCGCCGCTACGCTTGGTTATCCGATCTCCATCGCGATGACGTActcgtcttcgtctgcaGTGGTCGTCGTGTTGGCCTCGCT
TGGTGACAATGTCGAGGCCACAGCAAACTCGGCAGGTGGCTCCCACCTCGTGGCCAGCGTGTCCACGTTCACGTAGTACGGCGCTTGAGTGGCCGGGTCA
ATGTACATGACCCACGCGCTGGCGGCgcctgctgccattgcagctGTTGAGACGGACTCGGGCGACGCCACGACTCCAATAGGATCGCATCTTTCCAATG
GCGGCACCCACGAACTCTCTCCAGTCTTGGCGTTGTAGTAGAACAGCTGGCCGCTGGCCTCGTCCAGAAACTCTTGCCAGGTGCCGAGAGGCTCCGGTGT
GGACTTGCTGTCGCTAGGCCGGACGGCCTCAACGTCTGGGGCGCCCTCTTGTTGCATTGTGGGGATGACGTGTGGACTGGAAGCCTTCGCGTTGTCGATT
ATTGAGGC